Description :
From Genome Similarity Track
Location :
Scaffold_450:18302- 20545
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_450-abinit-gene-0.30Protein pelota
Pytve_DAOMBR484maker-pve_contig_450-snap-gene-0.23Trafficking protein particle complex subunit 2

Sequence
2243 bases(100 bases per row)
GCGGCGAAGGATGAAGCTGTTCAAGAAGCAGATTAGCGAGAAGGATGGCGCCGGCTCGGTCGTGCTACGCGCCGAGGAGCCCGAGGATATGTGGCACATC
TACAACCTCATCCATGCCGGTGACTCGGTGAAGACGACCACGATGCGCAAGGTACGTACGACGCGCTTTGCGCCATGATCTGAGCCAAGATATCCAACAC
AAATCCTGAACTGTTGGCTCCAACAGGTTGTCAAAGAAGGCGTGACGGGCTCCACGAGCAGCCAACGCATGCGCATGACGCTGCAGATCGAGGTAGAGCT
GTTATATACCGCATTTGATCCAGGAACCGAGTCGGGGACTGAGCCGTGTTGGTGTGGTGAGCAGGTGGAGCAAGTCAATTTCGACCCCGTGCTGTGCGTG
CTGCGCATCAAGGGGAAGAACATCATGGAGAGCCAGCATGTTCGCGTCAGTTCTCCTCGGTTGTTTTGGAACTAGTGTGTGATGAGTGCGCTGACTGTTG
CTTGTCAGCTTGGTGCGTACCACACGCTCGACCTCGAGATGAACAGGGACTTCACGCTGGCCAAGAACTGCTGGGATGTCATGTCGCTCGAGCGGATCGA
AATGGCGTGCGATATCACCAAACGCGCGGAGCTGGCGGCGGTGGTTATGCAGCCTGGGTTGGCGCATCTGTGTCTGATCAAGGGGGCTATGACTGTGATC
CGCGCCAAGGTTGAGCTGAGCATCCCCAAGAAGCGTCCAGGCAACACGGCTCACGCCAAGGCAACCGACAAGTTCTATGAGAACATTGTGCGCTCGATCA
AGCAGCATATCGACTTCAAGCTCGTCAAGTGCGTGCTGCTTGCGAGTCCAGGGTTCGTCAAGGAGGACTTTTTCAAGTTCATGACGGAGCAGGCCATTCG
CCAAGACGACAAGCTCATCCTGGAGAACAAGGCCAAGTTCGTGCTCTGCCATGCGTCGTCCGGCCACAAACACGCGCTCGACGAGGTGCTCAACGATCCG
GTACGCTCTACTGATTGTAAGTTTGCCGTTACCTCCACGAAACTCACCCACGATTGGTATCATTTGCAGGCTATCCAGTCGCAGGTGGCCGACACGACTG
CCGCGGAAGACGTCAAGTGCCTCGAGAACTTCTTCACCATGCTGCATGTAGACCAGGACCGCGCGTACTACGGCTACAAGCACGTGGCGCGAGCCAACGA
GAACATGGCGATCGAGACGCTGATGGTCACGGATGAGCTATTTCGCAGCCAGGACCTCGCGACGCGGCGAAAGTATGTGGATCTGGTCGAGAGCGTGCGT
GACAACGGCGGCAATGTGCGGCTGTTCAGCAGCCTGCACGTCTCGGGCGAGAAGCTCGGGCAGGTGAGCGGCGTGGCCGCCATCCTGCGCTTCCCAATGC
CCGAGATCGACGAGGAGTTCCAGGACGACTCGGACTCGGGCTCGGACGACGACGAGGGGAAGGACAATGGCGTGGGCGACTTGTCCATGGAGGGTCTGTC
CATGTGATCGCAGAAAGAGCACAACGCACGCTACAGCAGAATAATCCGATATACTCACGCGGCCACGCGCTGCTGCTGGACAAGCGTCTGCACCTTCTTG
TCGAACGCTGGCGAGCTCAGCCGCTCGCCAATAACGGCGAACGGGTTTGACATGGCGTTCACGTACGTCTTGTGTAGCTCGGCAAAGAACTGGAGCGAAA
GGAACAGAGACCATCGTCAGTAGACTCGTTGGCAATCAGCGTAATGCTGCCTCTCCTCACCGATCGCAGCTCGGACTCGCGGGTCGGTGCGTCCTGTAGG
ATCGCGACGAACTTGACGGACGTGTTGGTTACATACCCGTACCTGGGGATCACCGTCTCCTTGTCAGTGAGGTGTGTTTCCAACATGCATTTGGCAAGCA
GGATTCGTACACGCGATAGTCTTCGATGGGACCAAGAAAACCGAGGTACATGTCGTCACGGGAGCCCAACACACCGGCGCTGCGCATCTTTTCCTCGATA
ATGTCCAGCGACACATGCGCGATGTAGTGCAGCCCCAGGTCCTCTTCGTCGTCGAAAGTTCGCAGGTAGAGCGGACTGTTCTGCGTCCCGCACAGCGCAA
CACGAGTGTCGAACGGCACGACCAACACATCACACAGTTAGCCCATACACAGGAGGTATATACTAGAAACAGCATTAAGCAGTTCCGACGGCATCCGGCA
CTCTACTTACCGTCGCGCCGATGACTGCGACGCACGAGACCAT