Description :
From Genome Similarity Track
Location :
Scaffold_62:18300- 22127
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_62-fgenesh-gene-0.0Codanin 1

Sequence
3827 bases(100 bases per row)
TCCCTACCCCTGTCCTGAAGTGGCATAGGTTCGTCGCCCGAGCCAGCATGACACACAAAATCAAACAGATCCCACAGTACGTTCCCCCCCCTCAGCGTAC
CGTGAAGAGGGACTGGACCCAGCTCCGCCTGCCCGAATGCCCAAATGTGAGACCCAGTTGCGAGTCAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGGGTACACTTTGACTATATAAATATCAAGGTTAAAATGTGGGCCGTGCCACATTGTT
TCACTCGTCGCTCGTTTTCACCCGCCACAAAATAGATTCGCCTAAATCACCCTTTTTTTTTTTTTGGGGTCATGAATTAGCGCGAGTGGCACAGTGTGCC
GAAATGCTCTTTCGAAAGAGCATTTTGGCGCGAACGAACTTTTCTCGTTTTGTGTTTTTTGTGTTTTTGCGTTTTCAAATTGGCGAGCTGTCGTCGTTGC
CGCCGCTCCTTTCTTCCCACCAAAGGCCGCAGCTTGTCCGCGCGCGTGTCATGGCCGAGGACGAGCGCGCGGTCGGCGCGCAGGTGTGGGAGGCTGTGCG
CCGCCTCGAAGACGCCGAGCTGGCCGTCGTGCAGGCGCAGATCCTGCGCAGCGCCGATCGGCCACCGCCAGCAGTGGTCAAGCCAGCGACATCATCAGCA
TCGAGAAAGGCCGACACGGATGCGGACGCGGACGCCGTGGCGCTCGCGACGGCCGACGGCCACGTGCAGCGCTGGGCTCCAGCAGACCTAACGCTCGTCT
TCCTGCGGCACCTGCACGCGCAGTTGCAGGCCCATCGCGACCAGCCGAGCGATGGAGCGAGCAGCTCAGGCGAGAAAGTGGTCGAGGCTGTCAAGATGGC
TACACTTGTGCCATCAACAGCTGTAGGCTTTGAGTTGCACCGCGACGAGTTCCCTCAGCTCTCGGGCAATACCCAGCGGTCATCACCGGTCGTCTCGTCA
GTCGCGCCGACTGCGGCGCGTCACGGCAAGCGACGCATCACCACGACACTGGTGACGACGACCCCCGTGGCTCGGCCGGTTCCAACTGCGGTGGACTTCC
CGCCACTTGAGACAGCGACCGAGGCGACGAACAGCGAGAGCACCACGCGTCCGCCTGCGTGGACCAAGCGCAGCTTGCTGGAGCGACGGATGGGTGGTGG
AGATGCAGATGGCGAGCTCAAGACGCCTACGAAGACCACCGCGTGGCCGGCTGTGACGCGCAAGAGCGAGGCTCGGCCTGCGCAGAGCTTCACACCGGAG
AAGATGGCCAAGACGCCGACCCACGAGTTCGCGACGCCGCCAACGTCGACGCGGAGTATCGAGTACAAGAGTCCGCCGCGGCTGCAGCTTGTCACGGCCA
AGGTGAAACGTTCTCGTCGGACAGCGGCTCTGATGCAGGACGACACTAAGGAACCGTCGAACCAGCAGGAAGCACCTACTGCACCGAGCTTGACGGTCAA
GCGGAGAATTGGAGATGCCGCGCAGTTCCCAGTGAACGCTCAGGCAGCCAAGCTCTACGGCTTCCTCATCACCAACCGACTCGCGGGAACAACCGTCGCG
GAGCTTCAAACACTGGCGGGCTTACTCTACCGCACCGACTGTGCTTCTTCCGCTATAGCTGGAACCGGCAATCAAGCTGAAGAACATGAGAACTGCCCAA
CCCCGAGTGAGTTCTGTTGGCGCTCCAATTGCCTCCAGTTCGCTGAGTTCGCGTTCAACTGTCTCGACAGTGTGCTGCCACACCTTGGACCGGAACTTGG
ACAGCTCATCGACAAGGGACTCGAAGCTGCAGGAATCTGCTCAAAGCTGCGAGACAGGCTGCATCAACTGGCGAAAGAGCGTGAGGAGCTCCGCGTGACC
GAAAGCGCACGAATCGGATCCAGCCTCCCCATCCAAACTAAAGGTAGGACCATCACGACTGGAGTGGAGGGTTGTTCTTGACTGACACGTTTCAACTTGT
TCCAGCCAGCACTGTCCGTGACTTCGCGCTGCCATTCTGTGAGGAGACTGATTCGCGCCTGCACTACCGCTCGCCTGCCGACTCGCAGTTGTACTCGAAC
CGCGAGCGCGTGCGTGACAGCTTCCTGGATCTGCTGCGCCAGTTCCAAAAGCAGCAGCACAGTTTGCTGGGTATCGAGAATGCCGGCGTCGCTGCCAAGG
CGATCGAGTCGGCGCGAGCCCTGCTGGCGGATGTGGCGCCTGAGAACCGCTGGTGGTTCGCCAAGTTCTTCGTCCTGGAGCTCGTCCAAGTGGGGTCGAA
CCCGCTGGGCGAGAGCGACAAGGACCTTGTGCTCAAGATTATGGAGGACAAGCTCGTCGGCAAGAACCCCGACCGCCTGCGCAAACTTCATCGCCGATTC
ACAAGCCAAAAGACTGCAACTCCAGCGCCATCCACCTCGGCAAAGTCGATTGGCTCAGGATCGGCAGCCGCATCAAAATCTTCGGGGACTGGAGTGTCGA
CGTCGAACAATGCGCGAACAACAAAGTCGAGGGGAAACAGCGGGGCGATCAAACCGTCAAATCGGACAGACCGCAGCACCAACAATGCTGGGGGATCCGG
TGGATCGGCTCCAACGCTGATTGCGGACAATGTCACGGCTGCGTTGGGTCGAATGCGTCCCTTCTTCGCCGACAGTCAGCTCTTCTTCTTCCATTTCCTG
CACAGCTGCGACAGCTTCGAGTTCTCGCAGCTCGTGAGCCACCATCTCGAGGGCCAATTCGAAGCCATGCGGACATCCAAGTCTCCAGCCGATCCACGCA
AGACGTTCACCGAGGATGTGCTCAAGCTCAAGGTGGTCGCCAAGTTCGTCGGCTATCTGCGGTTCTCCCCGCTCTGGCAGGTGTCGTCGTCCATTGTCCA
GCGTGCCGAGCATAATAGCGCGTTCACCGTTGCCAAGAAGGAAGCCATCGACACGATGGAACTCGCTCAACCGTCTCGCGGACGCGGACTTGATGTCCTG
CAGCTGCTGGAGGACAGCGTCATTTCCGGCTCGATTGCGAAGTGCGTCCCGTGGCTCTGCGACTACCTCTCGATGCTGTCCCTCGACAAGTTGTCTGCAG
CTACGACCTACTTCAAGCAGCTCTTTGTCTTGCTTCGGTGTCTGTATCGCTCAAGGCGGCTTGCAGCGCTTGGCGAGGTCGGCCTGCACATCGGCGTGCA
GATTGAGCGCATATTCCGGATCCTGGAGCTTGATCTCGTCGAGTTTATGCATGATGGTCAGTCTCAAGAGGCGCAAAAGTGGTCACCGTCTGCACGTGTT
CGGCTCGCACTGGAAGACGGTGTTGGTCCTGCAGTCGACGACAGCAGACAAGACGAGTTGCCGTTCTTGTACAACCAAGTCTTCATCCAGACATGCATCA
GCGAGCTGGACGACTTGCGCGGGTTCATTCAGGCTCGCTCTGCGCCGTCCCATCGAGTCGCCACCTCTGGACGGGCGGGTAGCGGGTCAAAAGCATCAAT
CACTGCGAGCGGGCCAGTGCGGTCGCACCCTATCCGCAAACTTCGGCCTCTACAGATCATTCTCGAGGACAACCCTGTGGGCGGTGATCCCCCAAGTCAG
TTCGGTCGCATTTCTGACAATCCACTGAAGGAGAACGGCAACGACGAGAGCAACGACTTCAATCCAACCGAGCGCGACCGCGACGAAGAAGCCTCGATCC
AGCACGATGAACTGGAGGAGGCCGTCTTCAAGAGCTCGCCAAAGCTGAAAAGCGTCGTGGAGTTCGTCGTGGATGCCGTTGCCACCAACGTCTGCAACCA
CGTCATGGAGCACGTTGTCACGCCTCG