Description :
From Genome Similarity Track
Location :
Scaffold_60:18300- 19634
Transcript NameFunction/comments
Hyaar_Emoy2807167hypothetical protein
Hyaar_Emoy2807168hypothetical protein

Sequence
1334 bases(100 bases per row)
CACACTACATCGGCAGTGCTAAGAACCTCTTGTTTTCTGCCTGCTATTAATTTAGCCAGCTCTATCCCTGGCATATCAAATATGGCAGCCCTGGCGTCTT
CTTGTCCTGGTAAACGATTAACTCGGATGAATCTCATATTTTATGCATGCAATACGAATTAACAAAAATTACAAAACGTGCTATCCTGTTTTCTTATGCA
GAATCCCGTACTAGTGCTTTTGGCTTTTGTTGCTGTCAATACCATCTTCGTGACACTCGGAGCACTCTTACGCTTTTTGGCTCAATTGATGACACTTCCT
GGTCTTCTGGTGGCACTAGTACTAGGACTGATACTGGCTATCCGTCAAGTAGCCTCGCTACTGACTTACCCTGGCCAAATCAGGTTGGTGATTCGAGAAG
GTGAAGCCAGCTTTGCTCGGCTGACCAAACACCGGCTTCAGGCTTTCACTGAGGCAGCTTTGGAGCTAGTGGCGGTGCTGGACCCTATTGCCAGCAATAG
ACCAACGAGGCTGCGCTTTCTACAGGTCCACCAGAATTTTACTTTTGCTCTGGAGACGATGGCGCTGCCGATCATGGAGTCACTAGAGATCTTGGAACGC
GACGGACAGTTGGGTATCAATGGGGAGAAGTTGCTGAGTGCATTGCAACAGATTGTAATGCTGAACTCGCAGCGGCTGTCCGAACCCTGTTCAAAGTTGT
GCTCAGCTTCGGAAAAGACGTTTGAGCTGCAGAGGTGTGAGCTGTTCAATGAAAAAGAGGCAGCTGAGCAAGTGTCGATGAAACTACGGACCAGCAGCCA
AGCAAGTTGTTAAAAAAGGTCCTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN