Description :
From Genome Similarity Track
Location :
scaffold_1635:1830- 3282
Transcript NameFunction/comments
Pl_100467reverse transcriptase

Sequence
1452 bases(100 bases per row)
CCACTAGCCCTTCTTTATTCTTTAATGATAGGTGACTGGGCATTTGGCGGACAGGCGATCACACTCGGGCTTCCTCTTCTTTAATGATAGGTGACTGGGG
ATTTGTCGGACAGGCGATCACACTCGGGCTTCCTGTCCAAAGGATCGCGTCAATACAACGAGAGAATCTAGCATACAAAGCCACAACAGACAAGCAAGAA
GAGGAAGTTGCCCACTGAGCCGATGGTCAGTCATCCTCAGTTCAACCTGCCGACTCGAATCCTGCCCCTCCATGAAGCCTGCCGTCGCGCAAATGACAGT
TCGGGTGAAAGATCCAACACAAGGTTCGGTGGAGGGAATACATGAACTCAATTACGAGATCGCAGCGCCGCACGAAGCTGAGACGCGTTCAGAATATGGT
GATGTTGAGGCTAGAATTAATGAAGTAAATCAAATTTGCAACCACGAAGGTGGTGACTTGTTCATAGAAGGCATCGAGGACCTAACGACCGTGTTGCCGG
AAGTGAGAGCGACCACCGTAGAGGTCATCCAAGTCAGAGATGCGGAGGTGAACACATCGGATGAGATCGAACAACTACGCCGCATCATCTGGAAACCAGC
CCACCTCATCATCGAAAAAGGCAATACGATCCCTCCATGAAATACCTGTGATATCGACGTAGAAGATTCGACACCAATGGCGCAACACTGTCGACCCTTT
TTCGGTCGATCACAACATAGGCACTTGTTCTTAATGAAGCAAATTCAGTACTAATTTAGGGTTAAGGCCTATCCCATCGTCAATCCTAACCTTTATGACA
CACCAACTGCGTGCAATATCTTGATAGTTGTATTGTCATGCCTCCTATCGTCGCAGCTGCTATCTTGTCGGATCATGCCAGATCTGGTCCGTCATCTTCA
GACCTAGACCTTGCATCACATCTTCTCCAATGTAACTTTTCCGACACCAAGATCCCAGATCACACCCATCTGACCTCTGGTCATCATTCCATTAGGTTCC
ATCAGCCTAGATTGCGGATCTTCCACCTTGGATCCGGATCTTCGGATCTAGATATGATATCATCTAGATTTTAGATCTCTTTCTTGGAGCTATATCGCCG
GACCCAGATCACAGAACACCTGGATCCTAGATCACTTGGATCCTAGTCAGATCCGTAGTCCTAGATCCTGGATTCAAGTATCCGTATTTTTGATTGATCT
GGTTGATGATCGGGCCTCCAATCGCCACTTTCACCACTATTATAAGGACCTTGCCTGCAGATTTTTGAAGCCCACTTCACCACACAAAGTAGACGACACA
TCCATGAACAACTCTCAAGTAGATCAAGGTATATCTTCCTCGCGGACATGTGAAGAATCCCCCGCGCGACCGAGTACCGTCAATACGGCTCCACGTGATC
ACCCCACCAAGGCATCTTCACGTCACCGGAAGAGAGCATTCCACCCCACTGA