Description :
From Genome Similarity Track
Location :
Scaffold_459:183- 5349
Sequence
5166 bases(100 bases per row)
CCGGGTCATCGCCGGGAAACGGCATTTCCCAGTAGGCGCGGGGCGGCCTACTGGGGAAGAACTGAGCTCTGTTGTACCTCGAGGCGGTAGAGGGCAACGG
GGCTCAGCCCCGAAGAGAGCTGAGCTCTCTTACGAAAAGAGTGTGTGCAAGCCGGGCTTGCTGGTCGTTCAAGCGAACGTGAAGGGCTTTGCAAAGCCAT
AAAGAGTCTTGATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCACCCTGGAAGGGAGTCAGCTGTATGCTGAGGCACTGGAAGTGCCAACGAG
AGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAAGGCTCTGTCGACCTTGGAGTGAAGTTTGAGAACTTCATAGCGTGGAACG
TTGTTTGGTCTTAGACCTGGATGCGAGGTATGACCTCATCCTTGACATGGCATGGCTGGAACGTCATGAGCCATGGATCGACTGGAAGTCGAAAACGCTG
GGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGTCATGAACCCACCTCTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCACGAGGCCGAGGCGG
CCGTAGTGCTGGACATTGGTATGTCCGAAATTGTTAGCAACGAGGTTGCTGTTTGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCCGCTGAGCGGTGC
AGGTCAGGTCAATGACCAACTGCTGGGTCCTGGTGAGGACGAGCGCGGAGTGGCGCGTAATCCACTGAGTGGTATGAATCTGGTCGATGACCTACCGCTG
CGTGACCTGAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGTGGCCCAGGAGATGCAGGTGAAGTGACACCTAGTTCACTGTGTGAAGGTCAAG
AACCTCTTGGCTTTCAGCCGAGTGTCTTGCGAGACACTGTATCATCTTCGAGGAGTGAAGGTGCTGCTGCACTCGGTGGTGGTGACGGAGATGTCGCCAC
ACCGCTCTCATCCGGCCGGGATCGGTCGCGGAGGGAGAGGAGAAGAAGACGCAGGGCGTCTGTGACGTCTTCGACGTCGGACGATGTGTCCAACGTGACG
AGCGGTGATGCTCCACGTGATTGCTGTGAAAAGCTGTATACACTCGTGAACGGAGCGACGGGGGAGGTAGAAGACGATATCAGCCTTGACGCTCTGCCCG
CTGCAGATGCTCTGCTAGAGATGGACGAGATGTCCATTGCCGAGTTTGGCGAAGCCTTGAAGGCAGGCGAGCTAGCCGAGGTGGTCCTGCTGGGATCTGA
GGAGCAGTTATATTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACACCAAGAAGGCGCTGAGCGCACAAAGTGGATCGGCGATCCTCAAAGATCCT
TCGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCGAAAGACCCACCGACGGGCCTGCCTCCAGATCGAGGCGTGTGTCATGAGATTA
ACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCGAGAGAGCAGTGTGACGTCAATGACGCATTTTCCCGTGCGAAGCACGAGGC
AGGGATGGTGCGTGAGAGTAAGTCTCCGCACTCAACACCCACGTTCTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTA
AATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACGCTGTACAGCGCGCTCGACTTGGTCG
ATGGCTACTACCAATTGCTCATGAGTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCG
CAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCCGTACGTTGTACAGCGCGCTCGACTTGGTCGATGGCTACTACCAATTGCTCA
TGAGTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAG
GATGTTCTGCAGAACAACATGGTAGGCCGTACGTTGTACAGCGCGCTCGACTTGGTCGATGGCTACTACCAATTGCTCATGAGAGCGAGTGACATTCCGC
TGACAGCGGTGATTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCA
GTTGTTTAGGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATCCGTCCATAGTCGTGCTGAGCACGGAAAGTCAGACGTGGAAAACCACATT
GACCCCTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGATAAGTGCGTCTTTGGCGCGGAGGAAATACCTTTCCTCGGGT
GCTTCATTGGGAAGCGTGGCTTAAGGGCAGATCCTGCCAAAGTCAAGGCTATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCT
AGGCTTAGCCAATTACTTGCACAAGTACAGCGCGAACTACGCGGAGATGGCTCGGCCATTATCAGATCTCCTTAAGAAGGACGCACCATGGTGCTGGAAC
GTCGAGCACGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTTCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATCGTCCGTTTAGCGTCGTCTGTG
ACGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTGATCGCGTTGAGTCTCGCCAGCTCAAAGCTGCAGAG
AAGAACTATCCAGTTCATGACAAAGATCTATTTGCAATGAAGTATGCTCTAGTCGAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTA
CTGATCATGCGTCGTTACGCACTGCGACACAGTCGCCTCATTTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTTGAGGTGAA
GTACAAGCCGGGGCGGCTTAACGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGAC
TTGATACGCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGTTTAAAGACTCTGACAAGGAATTGTCTGGGC
GCTTACGCGCGAGGCTGCATCGATACTCGTTCGATGGCGGCCTGCTGTACTACAGCACCGACTCTGAGGATAACCCTCGTGTAGTCGTTCGTCATGATGA
GGATTTTAAGTATCGAATCCTCTATAAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTTGGGAGAAGCTATATGGCTCGGTGAGCTCGATGTACTGG
TGGACCAAGATGTATAAGTGGGTCGGCTCCTATGTACGCACGTGTGAGACGTGTCAACGGACAAAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTT
TGCCTGTCCCCAAGGGATGTTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCCAAGGACAAGGCAGGAAACACGGGCATTGTGGTCTTTGTAGA
CCGATTGAGCAAGATGGCTCATCTAGCGGCGGTGCCGGACACCATTGATGGTGAGGGTACAGCTTTGCTGTTTTTAGATCGAGTCTTTCGCCAACATGGC
TTGCCTGAGGCAATTGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGAGTGCTCGGCACTCGTTTGGACATGTCCACAG
CGGACCATCCGCAGACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATATCCTCCGAAGCGTTTGCGCTGCGGCGCCAAAACGCTGGAGCCA
GATGTTCCCACGCGTTGAGCTCGCATTAAATAATGCAGTGCACGCCTTGACAGGCTACACTCCGTTCTATGTGAACGGCTTGGTTAACCCTCGCGTCCCA
CTGACGCCGCCGCGCAGTGGCTCAGGGCTTGATGGGGGAGGGATGGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCGGTTCGCAAGCAAGTCGATGACT
TTGTCTCTATGAGACTGAGCGTAATGCGTCAAGTGCGCGACGCTATGGCTGAAAGCCAAGACACGCAGAAGGAACATGCAGATGCCAAGGGCAGAAGCAA
TGTTGAGAGGTTTGAGGTCGGTGACCAAGTTTTATTAAACGCTAAAAACCTACCTACTCATGCAGTGTCTGCAGTCTTCAAGACGAAGTTAAGATCTCGG
TTCATAGGACCGTTCAAGGTCGTGGCCAGGAAGAGCCTAGCGTATACGCTCAACCTTCCGAAGAAGATGCGCACGCATCCGGTCTTCTATGTTGGCTTGC
TTAAGCCATACCAAGACCCTGCTCAGGTGAGCGCAGAGGCGTTGGCACCAACGGTGGCTGGGCCACGGACAGCTGCAGGGCAGCAGGTGGTAGAGCCACG
GGAGGCTAAACGACAGCAAGTGGTGGATCCACAGTTGGCTGATCAACAGCATGTGGCAGAGCCACAGGTCGCGGAGCGAAGTGCTCGAGATGCAGGAGCA
AGGCAAGCTGAACGTTCAGCCGAGCGACTAGACGCTCAAGGTCCGAGACCTGGTTGTGAGTCAACAGTGGTGGCTCTAACCTATCCACAAGGTGGATCAT
CTCTTCGAGATCGACCGATGGGCGGTGAACGTGAACGTTCGCGTCGTGGACGCTGGTGTCGTATGGACGCAGACGCCGTTCCGGCAAGTGCTGACTCTCC
CCGCGAGAGCCCAGCTGAGGCAAGGCCTCCTCCTGCTCTGCTCGATGAGCATGGTGAGCTCCACTTTCACGTGGAACGCCTTCTGGCCGGGCGTAGACGC
CAGGGTCGTACCCAGTACTTGGTGAAGTGGAGGGGTTACCCTCACTCACAGAACTCATGGGAGTTTGAGGTTATCCTCCGGCAAGATTGCCCTGACGTCG
TTGACGCTTACGAACCGGGCACATCATGTGCCGAAGCGCCACCATGGCGTGCGACAGCGTCGCCAG