Description :
From Genome Similarity Track
Location :
Scaffold_10:183- 4270
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_10-fgenesh-gene-0.0Sodium/hydrogen exchanger

Sequence
4087 bases(100 bases per row)
GATGGAGGACGCCGTGCTCGTGCTCGCGATGCTCTTCGTGCTCGTCATGTCGTCGTTCATGCTGGACCGCTACTCGTGCATGGTCATCTCGCAGTCGGGC
TTCGCGCTCGTATTCGGGCTCGTGGTCGGGCTGCTGCTGCTCGCCACGGGCAAGCGCGCGTCGCTGAGCCACCACCTGAACCTGGACAACACGCTCTTCT
TCGACGTGCTGCTGCCGCCGATCATCTACGAGGGCGGCTTCTCGATCAAGCGCCAGGCGTTCTTCCGCAACTTTCCCGCGATCATGAGCACGGCTGTGCT
CGGCACGGTCATCGCCACGTGCATCACGGGTGGCGTGCTCTTCTTCGCCGGTCAGGTCGGCGCCGTCACGGCGCTCTCGTGGGTCGAGGCCTTCCTCTTT
GGTGCGCTCATCAGCGCCGTCGACCCGGTCGCGACGCTCGCGTGCTTCAACAAGCTCAACGCGCCGCCGCTGCTCTTCAACCTGGTCTTCGGCGAGAGCG
TGCTCAACGACGCCGTCGCGATCGCGCTCTACCAGACGCTACTCAAGTGGAAACCCGACATTGACCTGAACGCGCGCGAGCTGCTGCTCGTCGCGGTCAA
CACGGGCGGTATGTTCGTGGGCTCGCTGCTCGTGAGCTGCGTCATCACGCTCCTTGGCGCGTTCTTGCTCAAGCGCAAGATGTTCGAGACGCTGCGCCAC
TTCCCGACCTACGAGATCTCACTCTGCCTCATCTTCAGCCTGCTCACGTACTTTGTGGCCGACAGCATGAACCTGAGCGGCATCGTCTCGCTTTTCTTCT
CCGGCACCATGACCGCGCACTACCACTTCCACACGATCTCCAAGGCCGCGCAGCACTCGTTCACGCACCTGCTGCACACCACGGCGTTCATCTGCGAGAA
CATTGTGTACGTGTTCATGGGCACGTCCGTCATCATGCTCTTCGCGGGCCACGTGGACAAGGACGCCGGCGCGGCGCTGCGCGTGGACGACATCGACTGG
AGCTTCATCGCGCTCACAATCGCGGCCTGCGTCGTCGCGCGCTTCTTCAACATTTTCCCGCTGCTCGGGCTCTCGAACTGCTTCCGCTCGCGCTCCGACA
AAATCTCCACGAGCTACATGACGGTCATCTGGTTTGCGGGTCTACGCGGCTCGATCGCGTTCGCGCTCGCGAAGAACTGGTCGTACATTGGGCTTAAGGG
CAGGTCGCACCACAAGCTCATCGAATCGACAACGCTCATGGTCGTGCTCTTCACGACGATCGTCGTCGGTGGACTCACGGGTCCGTTCCTGTCGCTCTTG
GGCCTGGCGAACAGCGAAAAGAAGGACCGAGCGCTCCGCACCGGTGACGAGTCGGACGCTGGTACATCCACTGAGAGCAGCGGCACCACGTCGCCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCGCGCCGCTCGATGCACTACATTGTGAGCCACGGGAGCTCGGACCAGCCGCCGTTCGTCGAGGTGCCGACGTCCGAGAGCACGGCGACGACGCTGGAC
CTGCTCAGTCGCGACGCAGTGCTGACCCCGCGACCGCAGATGCTCGACAGCGACAGTGACGAGGACGCCGACGATTTCGAAATGCGCACCGCGCAGACCC
ACCCGCCGGCGATCCAGCGCGCGACGTCGAACTCGGGCCGCGAGTCGATGACCGGCGCGTTCTTCCGCTCATGGCAGGCCTTTGACACGTCGCGCATGCA
GCCGATCTTTGGTGGCGCCCACTCGCAGCCGGCAAACTTTCAATCGCCCCGTTCTTCACAACAGGAGAGGCAGCAGCAGTCGCCGACGACCAGCAGCCTG
CAGCGCGTGCTCGACACGGCACGGAAGGAGACCATGGTGTAGGTATTTTTTTATTCTCAAGAGCGAGCGAGCAGCTCCAGACTGGAGCTGAGGCGACTGT
CGATCAGCTCTTTAGCTGCATATCCAGACTTCGCAGCGAGTATGCCGCAGGCTTAGTCTCTATCTATATGCATGTGCATGAAGGAACCATTTTCCATTGC
GTTTGGGCCCTGACTTCCAATCCATAAATATGGCCAATTTATGGCAGATATGGCCATTTTATGGTCGTTTCTTCTCGCTAACAGTAAACCGAGAAACCCT
TTCTAAAACGATCAATAGCTGGCGTCACGACCTGGAGAACGAACGTAAAGCGCACGCGTTGAGCAGCCTATAGAGCAGGCTATCGCAACGGAACTAAGGC
GGAATAGAGAGACCGAGTGGCAGCTCATGGCGCGGCATGGGAGTGGCGACGAGCGTCAGCATCAGTCGCGGCTGAGGAGAGAGGAGGCGAGCGACAACCA
GCGCGATGCAGACAACGGCGAACAAGTGGCGGACGAAGGGGACGATGACGACCACCTGCCGCCGATCGACGAGCTCGAGAACCTGATCCTTGAGGCGTAC
AACAACATGCAGAGCGACGGCGAGTTCATCTTCCTGCCGGACGAGGTCGCGCAGAAGCTGCACCAGGTCGCGAGGATGGTACGTGCGCCTTTGCGTTGGC
GCTTATATTAATAAAGTGTTGTGGCCTTGGTATTGTCACTGGACTGTGATGCTGACTGCGTATACGTGTGGCTTTCGGCAGATGCAAGGTACGAGTATGG
ATGCTGCTGATGATGACGAAGAGCAGAACCAGTTGGAAGCAGAAGCTGCTGGCAGTGACGACGAGACGGGGGCATCGCAATCCACCGAATCGCTACAGGA
GAGCGATCTCCAAGAGCCCGAGGAAGAGGAAGAGCAGGAGCAGCAACAACAACACCAGGATGAGCGAGTGGCTCGACCACTGATAAAGCAGCAGCAGCTG
GAGACCAAGTTCATGGAGCTGCCACCCGTTCTCGAGCTCGACGAAGAGGTGCGAAAGCGATGCATGCGCTTTCTTTCAGCAATGTAACAGTCCATGTTTC
TAATCACACAATGTTATTCATTATGCAGGGCTCGAGTGACTCGCATGTTGACAGCCCAGCGACAGAGCGAGAAATTTTGACCGTCGCGCCGCCGCCGCCG
AGCAGTGGTGGCGGGAGAAGAAAGAGCCCCATCCACCCTCCGCCACCGCCGTCATCGACATCATCGTCATCGTCAGCATCATCATCACACGTCGCAGTTG
TCCCTGCGAGCCCATTGAAAGCAAGCGCAAGGACAACATCGTCGCCCTCTGCCCCCACAAGCAGCAGTCGACTGCGCGCGCCACGCGTAGACTCCAAGGT
CGCATCCTACGAATCGCGACGAGAGGCCGCGCAGAAGCTGAAAGACGACAAGATTCAGCGCGAGCAGCGCGCACGCGACTCGGCCAAGAAGCAACGCGAA
GACGCGCGCCGCAAACTGGAAGAAGCACACCAGCGGCAGCTCGAGGAGAAGCGCGAGCGCGTGCGACGGATGAAGATGCAGCGCGAGCAGCAAGCCAAGC
CGCCCGCGTCCGGCAAGAAGCCTCCTTCAAGCTCCGGAAGCGCCAAGTGACGGGTAGGCTTGTTGTGCGTTCTGTGCGTTTGTGAGGGCAAGGGAGGGGC
TGATGTAGCGAAATATAGGGGCGTGTGAGTTATTATATCGACTGGAGATCTGCTGTTGGTGTCTTTCCCAAGCGCGCCAGGCACTCTGGATCTACCTGTC
GCAGAAGCATGTGCATGCCATCGAGCGAACTGGTTACAACCTGCAGCTCGCGGCTCAAGTTGCGGCGCTGCAGCTCCATTTTGCGCCGCTGGTGCTGCAG
ATTCGCCTTGTACTGCAGGAGCTTGCTCTGTCTCCGCTCGATGCACCTGACAAAGAATAACAGCAGCAAGAAGGTGTGTTAGATGGCAGTGAGGTCTTCC
TCATTATGGGCGACTTGTTACCAGACCTGGTACTCTCATCGAGTTTGGTGGTACAGTAGCTGGCGTACTGACAGGAGAGCTGCAGTA