Description :
From Genome Similarity Track
Location :
Scaffold_2622:183- 3029
Transcript NameFunction/comments
Phypl_g15258hypothetical protein

Sequence
2846 bases(100 bases per row)
GGGTTTATGAAGATATCCCGCTCGGGCGACCGTGGACAACTGACTGACTTGTTTGAAGCGGGCGAACCCATCGATCCGGGTAAACCGTCAGTGCTGGGGC
GCCGATCATACATCGATGACATCCTGGTGACTGCCGGATCGTGGGATCAGCTATGCGATCGAGTGGAAGATCTGTTGGACGCATGTGATGAGTGGAATCT
GTCTATCAGCGTGGTGAAGAGTTTTTGGGGGCTGAACAAAGTGGGCTATCTGGGACACCAATTGTCACCTGGTGGGTTGGAAGCTCACCCGAAAGACCTG
GAAGCACTGACCGATCTATATTTCCCGGAATCTCTCCGATCGATGCAGTCGTTCTGAATTACTATAGCCGTTTCATCGAGGACTATGCGATCTATGCCGC
GGTCCTGTACGAGCTACGTGAGGTGGACTTCGCTGAACTGCGAAAGCGGCGAGATCTCCGTCAGTTGCTGGATCGATCGTTGCTTGATCGTGATCCCACG
AGTCCCGATCTCGGGACGCTTAACACGACCGGATCGGACCCTGTAATGCCGGGATCGAAGGCCGCGGATGAGAGATGGGTTCGAGCGCAACAGGTCTTCA
AAacgctgaaggcgaaggtAGCCACGACGCCGATCCTACGTCGCTTTGACCCCGATCGCCAGGCAGTGGTGATCGTGTATGCCAGTGAGTGGGCGATCTC
GGCGGCTTTAGTGCAGGATCACGAACAAGTCTACCACCCCGTCATGTTCGCAAGTAGAACGCTCAAGTCGAATGAGTTGAATTAtaacgtggtggagaag
gaagtATTGGCCCTCTTGAGAAGCGTGGATCTGAACTACAACATGCTGGTGGGACGTCAGATTCGGATCTTGACTAAGCATTCCACGTTGGCATGACTCT
TCAGATCGCCGGGACTCCAGGGACGTCTTGGACAGTGGGCCGCTCTCCTATCACCTTGGACACTCGAGATCGTGAAGTGCGTGATAGGGGAAGACGAGAT
CCTAGGGGTGATCGCAGCGAGTATCACGCCCCGAtccaaggtggacgaggtgctgactGCGATCGCACCCAAAAAGGCGCCACGACGTAAGATCCAAGCT
CCGATCCCGACCGTGGGGACGGGCGAGGAGCTGTTTGAGGTGAGCTTTGACAGATCTGCCCGTGTTAAGTGTGGCGGCTGCGCCTACAGCGCGATCTTGT
GGGAGTTGCCCGAGTGGACTGTTTTGAAGGCCCGACCGGGCTATGCGGAAGGGCTGACTATGAACGAAGCGGAGTACAACGGTCTCCTACTATGTTTTGA
CCTGCTGGATGGAATGGATCAAGGGCGCCTGGTAATCTGTGGCGACTCGAATCTAGTAGTCCGGCAAGTCCGAGGTGAGATCGATTGCAAGGCACCTGGC
TTGACTCTGTTGAGACAGAAAACCCTCGATCGACTACGTGCCTGACCCGATCACGAGATATTGGATGTCAAACGGGATTGGAATGATAGTCCGGACAGTC
TAGCCGGCGCAGccctccagcggcagcaaggtgtggtggtggagagcgaggaagagTATCAGGATCTGATCACCCTGAATCGGTTAGACGAGATCCTAGT
CACCCGATCGGAGGATGCAGTGGTACGAGTCTCGCCAGTGACTCCCCGATCAGGCGCTCGACCCCGATCTGACCCACCTGTGCTAAACGAGGAGTTGGTC
CGAGACCTTCGGATCGAGCGGATCCGACaggcgcaggacgaggaAAGCTGGAACTCAGGCATGAATAAGTATCTCGCTGGTGATGTGACGGATCTCACCC
AAGATCAAGCTAGATCACACTGAAAAATGGTCGCAGATTACGAAGTAGATGACCACGATCTGTTGTTCTACTGCCTCCCTAACAAACGATTGGAAACCGA
TCGGGACGGACTGATGAGGCTAGTCGCCCCAGAGACGCTCCACCAAGATATCCTGCATCATTATCACACGAGTATCGAAGGCGGTCATCAAGGGATCGGC
CGCACTTATCAGCAGATCCGAGAACAGTTCCATTGGAAGGGTCTGTTTCGAAGCGTGCATAGATATGTTGGTGAGTGCATGGATTGCGAGGCGGGCAAGG
GCCGGCCTACGATCAGGGGTGAATCGCCCGGGAACCTCCAGGCGACGTATCCTTTCCAGATCATTGCGATGGATCACATCCCATCTCTCCCAAAGTCGTA
TAAGGGCAACACTGAGTTGTTGATCTGGGTAGATCTCTTTACCGGGTACGTGATCGCAAAGGCGAGCGCGTCCCGAACGGCTCAGACGACCGCCGAATCC
TACGAAGAATGCGTCTTCCGGATATTTGGAGCTAGCGAGGCGATCCGACATGATCGGGAGCCAGGGTTCATGTCCGACTTCTTCTGTGCCTTTAATACGA
TCCTCAGTCAACGTCAGCGGGCGACGATGGCTTATCGGCCACAAGCGAACGGAACGGCCGAACGAAtggtgcagacgacgacgcgcgcgtTAAAAATGTA
TGTACAGAATCTGGATCAGCGAGATTGGGACGATTATGCCGAGAGATTGACGTTCGCTATCAACACGGCTCAAGATCGGATCCGCGGAGATACGCCTTTC
TATTTGGTACATGGATGGGCTCCGAGATCGACGTTGGAAGCAACCGTGCCACTGGGTAGTGTGGCGTATGGAAACACAACTTTTGGGCGCCTACCCTAGG
CTGCCTAATCAAGGCACTTGGGTACACCCGGATCGACTCGGTGTGAGTCCGACGAAGCTAAGTACGATCCGACTTGGCGAGGACGCGACCTAGCGAGGAT
CCGACTCAGCGAGCAAGGTTATTTGACCCGGCGAGGTTAAATCAGA