Description :
From Genome Similarity Track
Location :
Scaffold_2895:183- 2622
Sequence
2439 bases(100 bases per row)
TCCGAGCCGTCGGATCCTGACTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACT
TGCCGGACCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCTCGCAGTACTGCTTCAAGCTCGTCTGCGTCGGGAAGTCGTAGCAGGGT
CAGCCTGTCGGCCAGATCCACATCTCCCAACGTTTCTGTAAAGTAGTCCACGGGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCC
CGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAACGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCTAATC
CACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTTGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAG
ATCCGCAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGA
TCCTTGCCCGTGAACTCCTTCAAGTCCGATATAGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCCGTTGCTACCACGG
CTGCCGAAGTGGATGGGCCATCCAGATCGTCTGGGTCGAACTCATCATGGGAGTTGTCCCCCTCTACTGACTCCATCTCCACGTCCCGTGCTCCATGTTC
GTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATGCCCTGTTCGGCCAGGAAGCGATTCATCGCAGCTTCAAAGTGCCGCTGCAGGGTGCCCGAGGAA
GTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGGGACTGGATCCGTGAGGCGATTACCTCGAGCCTGATCTGACGATAATCCCACTGGCTTCTTGC
CGGATCTGGCTCGATCCTGGCTGGATTGCGTCAAATCACGCGTAGGGCGTACTGGATCCCGAGCTTTCACGTTCACAGGGGCTTCCTGTCCTCGGATCCT
CGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCATAGTTT
GAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTAGATCCATAGTACGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCG
CGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAGACGTAATAGACCTTTGAC
TGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCCCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGC
AGGAAATCGCGTAGAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTT
GCATCTTCTTCCGCATAGTCTTACTCGTTTTCGTTTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGCATC
TGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGA
TAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCAACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCA
GCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACC
AAAAGATCCGGGCACGCGCACCATTGTGATGTAGCGGGATCAGCAAAATCTGCGAGATTGCCGGATCCAACTTACCAACTGCGCCCAGACACCGACTAAC
GGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTATCTCGGTAACTTCCGAAGAGT
TCAAGTGGTGAAGCTTGAGCGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCTGTGGATAATTCCGAATCCTAA
GCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGAGTGTATTCCCTTGCTTTTGTAGTTCTTTTGCGTCG
TACTTGCCGCCTTCTGTGACGGGATCTTGAGAGTTGAGA