Description :
From Genome Similarity Track
Location :
Scaffold_4087:183- 1287
Sequence
1104 bases(100 bases per row)
TTGTTGACACAACAACACGGCGTCCTGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGA
TAAAGCTGTCACGCCTATCGTCAAGTTCCTTATGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGGG
TTTAAAGAGGGGTCTCCTCTATTAACGGGTGGAGCCCACTGATCCTCCACAGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGATATCCTCGCGACC
GATATGAGTTTAAAGAGGGTCTCCTCTATTAACGGGTGGAGCCCACTGATCCTCCACAGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCT
CGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGAGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGG
GTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTT
GGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGGATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACA
TCTTGCTCCAGTTCCCGTCACTGTTACGGACGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCG
GACCGAGACCCGCGGTTCACTGCTGCGCTTTGGAAAGCGCTGTTCCCTTTGCTGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACG
GCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCAGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTT
TGCGCTCAACAACGCGGTGCACGCGCCACGGGGTTCACGCCGGTTCTACTTGAACGGCTTCCGCAACCCCAGAGTGCCTTCTCAACTCTTCGAGAGAGAC
ACTG