Description :
From Genome Similarity Track
Location :
Scaffold_102:18288- 20850
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_102-fgenesh-gene-0.4Peptidyl-tRNA hydrolase
Pytve_DAOMBR484maker-pve_contig_102-fgenesh-gene-0.11Calcineurin-like phosphoesterase

Sequence
2562 bases(100 bases per row)
TGGACGAGGTGGCGTGGAAGTGCTCGGCGGCGTTCGTGCTCGGCGCCGCGGCGCACTACGTGGCGCGCAGCTACCTCTTCCCATCGCTGGACGCTGTCAA
GAGCTCGGGGTCCAGCGAGCCTGTGGCCGACGACGCCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGGAGGAGGAGGACGAGGACTGGGATGA
ACAGAACTGGACGCCGCACAAGATGGTGCTGTGCGTGCGCACCGACCTCAAGATGGGCAAAGGTGGGCTTCGAGCGGCAGTGTCTGGCAGTGGTTCAATC
TTCTTTAAGGTTCTTACGTTGCTGGGATGATGTGTTTGCAGGCAAGATCGCGGCTCAGTGCTGCCACGCGACGCTCGGTGCTTACAAGCGCGCGGTGCGA
CGCACGCCAGCGGCGGTCAAGGCGTGGGAGATGCTCGGACAGGCCAAGGTGTGTCTCAAGGTCGACTCGGAGGCGGAGCTGCTCGCCATCGCCGAGAGCG
CGTCCGCCAAGGGGCTCGTCAGCTATGTGGTGGTACGAGCTGTGTCCTTGTTTTCATGGTGAAACTGAGAAGGAGGTTCTGATGACGACGGTATGCACGA
CAGATCGACGCGGGCCGCACGCAGATCGCGCCGGAGAGCAAGACGGTCGTGGCCATCGGCCCGGCGCCGCTCGACGCCTTCGACGAGGTTACGGGTCACC
TCAAGCTCATGTGAAGTTTGGCAACTAGACGCGAGCGGCAAACAGGGAAGCAATCAAAACCCGCCGCTTATATTGACAGATTGCTGGCAAAACGCCCCTC
TCGTGTCTGAGACTGCAGTGGTGGCGCTCGCCTACAACATCGGGAAGACGTTGTCGTACTGGCTGGCGCGCTCGTCGCGCGCGCGGAAGACCTCGTGGCG
CCGCAGCGCGTGCTGGATCCCGACGACGCAGCCGACAGCGATGAGCGTCGCGACGAGCGTCGTGCCGACCGTGATGAGCACGTCTGACGATGACACATCC
GATGGCGACGCTGACGACGGCGCTGGCGCGGCGCCAACGGAGGCGTGGTCGGGCTGCGAGCCGCCATCTGCGCCAGCGAACGCCTGGCTGTCGACGCATG
CGAGGTACTCGCCGTTCGAGGACCACCACTTCATGGTGCACAGCAGCTTCGCCCAGCAGTCAGCAGTGTCGCAGCGGCGCCACACGGGCGACTGCGCCTT
CATGTTCGAGTTGTACTCGGTCAGCAGACTGCCGTTGACGCGCGCGCGCTGCACGTACGCGTCCAGGTCGCTGGCCGCCAACGACTCGACCCCGTACGCC
CTGATCATTCCCACCGCATCGCACCGTCAGTCAGTCAGCTATCGCTACCCGTCAACCATGGAAGGGAAGAACCTTACGTGGTGGCGCGGAAGAGCTCTTG
CCAGTCCAGCACCGGCTCGCTGTCCGAGATGTTGCTGCCGTAGACGGTGAAGTCGAGCAGCTCGTACGTCTCGGCGTCAATGTCCCAGACCATGAAGGAC
GGGTTGTTGCCGAACAGGGGCGAGATGGACCCCGTGACGAAGAGCGGCACCAGCTTGAAACTCTCGTCGTCCCTGCCGCTCTTCCCCTGCTCGAGCGCGG
GCACGGGGACGCGGAACTCGATGCTGTGCACGTGGCCGAACAGCTGCGCCTTGACCACGTCCGGGTACCGGCCCACGATCGCCTTGTACCGGTCGATGTA
GTGCACGTGCCACTGCGGCGCGCCGCCGTACGAGTCGACGATCGGCGCGATGTGGCCCGTGACGTAGGCCACCTTGCCCTGCTCGCGCAGCGCCGCGAGC
GTCTCGTCGAGCCACGCGAACTGCCCGAACGGGTCCAGCTCGCTCGACGTGTCTGGCAGGTGGCTCGGCTGGCCAAGGTGGAGTGTCAGGAAAGGCGGCG
CGCATACTGGATCCAAGTCAAGAAGGGACATCGACGACGTACCGAGTAGGGCACCGTGTTGAGCGTGATCACCTCGAGCCTGGCGTCGAAGGCGTACTTG
AGGAAGCCGCGGCGCGTGAACAGGTCGAGTGCGGGGGCCGAGAGCGAGTCGCGCCAGGCGCCAGCGATCAGCTCGATCGACGGGCTCGGCCCAGCCTTCG
GGTCCGTCACGTCCATGTGGTAATCCGGGTCTGCGCTCGCAACATGCTGCAAGTCAGCGCCTCCACTCTCGCTGCATAGTTTACAACCCTCTCATTGTCG
AACGTACTGCCGTCAGCGTTGCCGATGATGGCGGTGGCCTCCAGCGCCGGCGCGTCATCCTCCGATGGCGGGTAGTACTTTTCAAGCAGCCCGACGTTGG
TGCGCACGGCGGTGGCGATGTACGCGTCCGAGAACTCGCCGTGCGCCGCGTGGTCGCCCGTGTATAGCAGCAGGTCCGGCCGCGGCGCCGCGTGCTGCTG
CNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACGCGAGCGCCGACTCGAGCAGCGCCACGGGGGCGTCCGCGAAGTAGCGGATAGGGATGGCGGCCGACTC
GCTCGCGTCCAGTGACTCGGACAGGTTCAGGTGCACGTCCGACAGGTGCAGCAGCTGCAGCC