Description :
From Genome Similarity Track
Location :
Scaffold_3:1828715- 1831067
Transcript NameFunction/comments
Phypa_INRA-310PPTG_01737hypothetical protein
Phypa_INRA-310PPTG_01738hypothetical protein

Sequence
2352 bases(100 bases per row)
GATATCTTCCCTGACAAGGTTCCAGAGGCCTTGCCCCCCAGATCCCGGCGTGCGGCACGAGATCGACCTCGTGCCCGGATCCAAGTACTGCGTGACTCAA
CAGTGGCCCCTTCCCCGCGACCAAGTTGAAGCAATTGACGCCTTCTTAGAAAGTCGCCGGCAAGTCGGCCACGTTTCCGATAGCCTGTCACCCCATTCCC
GCCCTACCTTCTGCGTTAAGAAAGCGACGAGCGGATGGAGAATTATCCACACTTTCAACGAGCTCAACGACGTCACGATCCCGGCGCAGACGCCGATTCC
CCGCAAGGACATGGTGCTCGACACCATGTCGGGCAGCACCACTTACAGCGCGATTCATCTGATGGCTTATATCAGATCCTGATACGAGAAGACGACGTCC
CGCTGACCGCTGTCAGCACGCCCAGCGGCATGCTTTGGGAATGGCTCATGATGCCGCAGAGGCTCAAAAATGCCCTGGTCACCTTCAACCGTATGGTGTC
CAACCTACTGTGCCCGTATCACGACTTCGCACCCAGCTACATCGACGACACCTTTATTCACAGTCATGCCGAGGACGGCATGATCGACAATGAGGTCCAC
CTCCGGCACCTCCGTGAGGTGTTCGAAGTGATGCGCGAGAACAAGCTGTATGCGAACTTGAAGAAGTGCAACTTTTGCGCTGCCGAGATCCCAGCACTCG
GGAGCTATGTCGGCAAGGAAGGGGTCCGTGCAGACCCAGAGAAGATCGCGGCCATTTGTGATTGGCCAGCTCCGCAGGACCAGAAGCAGCTGAGGCAGTG
GATCGGGCTCGCCACATACCTCCACCACTACGCGAAGAACTTCGCCCGAGTCCGTTCACCCGCTCTCGCAGCTCCTCAAGGAGGACGCCACATGGACATG
GCGTCCTGAGCACCAGTCGGCATTCGACGCGGTGAAGGCGAGCTTATCCACCGCGCCCGTTCTCATGCTTCCTGACCGCTCGAAGCCGTTCCACATCGTT
TGCGACGCAAGCGACTACACCATTGGGTGCGCCTTGATGCAGTTCGGCGACGGCGGGCGCGAACAAGTTAGCAGCTAACAGTCTCGCCACCTGAAGCCGG
CGGAGCGCAACTACCCCGTCCATGATAAGAAGATCCTAGCCATGCGCTACGCACTCATCAAGTTTCTCGTGTACCTGTAGCGCGCAGGCCTTCGCCATCT
ACGCCGAGCACGCTTCGCTACGGACGGCGACCAAAAGCCCGCGCCGATCCCACCGTATGGCGCGATGGTTTTCCCTCTTCTCCGAGTACAATTTTGTCGT
GCACTACAAACCTGGCAAGACCAACATCCTCGCCGACGCGCTGTCACGTCGGCCGGACTACGTGCAGTCGGGTCGCCTTGTAGTTGGCGACAAGGACGAT
GACGAGTGTGCCGTGTGCACAGCCGGAGAACTCGGTGCGTTTGCAGTTGCCGCGAGCAGCCCTCTCCGCGACATGATAGTGACCGCGTACGAGTCCGACG
CGGCGTACATGAATGCGATCAAGTACTTGCAAAACCCGTCCGACTCGGCACGGCGACATTTGTCGACGCGCACCCGTTCTTGCGTCGACCGACACGGCCT
TGATGGTGATCTGCTGGATTACCAGGTTGATCGTGACGACCCACCGCGCATCGTCGTTCCGCTCGACGACGACCTTCGAGCTCGTCTCATTCACGAGTCC
CACGATTCTTCCAGTAGTGAACATATTGGACGCGAGAAGACGGTCGCGTCACTCTCGCGAGACGCACATGCACAAATGGGTGCTCAAATGGATACGCTTC
TGCGAAGCGTGTCAACGTGAAGCCCTCGCATTCGAATCAAGCGCCACTTCGTTCACTCGAAGTGGCTACTGCGCCGTGGTCGTCCGTCAGCATGGACTTC
GTTTTCGGTCTTCCCCGTGATGTGCAAGGCCGTACTGGAATCCTTGTCTTCGTCGACCGGTTCAGCAAGATGGTCCATATTACTCCAACCGCCTCCACCA
TCACCGCGAAACAGTCCGCGGCGATCTTCTTGGATATTGTCTATCGGCATCGCGGTCTGCCGTCTTCGATCATCTCCGACCGCAATCCAAGTTTCACTGC
GGCTTTCTGGCAAGAGTTGTTCCTCCTCCTCTGGACGCGGTTGAAGATGTCCACCGCGTCGCACCCTGAGACGGACGGCCAGACTGAACGAGCAAACCGA
GTCGTCGAATATTTTCTACGCAGCTTTGCTACTTCGTTCAAGTCCTGGAGCACTTTCCTACCGATGGTCAAATTTACCATGAGCAACGCTATCCATGCCT
CGACGGGATTCACCCCATTCTCTGTCAACTACGGACGATATCCCCATGTCCC