Description :
From Genome Similarity Track
Location :
Scaffold_2974:1828- 3269
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2974-snap-gene-0.2Amino Acid/Auxin Permease (AAAP) Family

Sequence
1441 bases(100 bases per row)
CACAGAACGGGAACTTGTATCCATCACCCGAGCCTGGGGCGAAGAGGTTCTTGCCGGTCTTGTAGGTCACGTAGGCGCCGAGTCCCGTGCAAATGACGAC
GACTAGGAAGCCAAGGATGCGTTCGTACTGCGGCAGGCGCGTGCCCATTTTCTTCTGGTAGAACAAAATGGGCAAGACGATCGCACAGCAGGTGATGCAG
GACGCACCGACGAAGTCGGAGAGATCGATAAACTTGTCCTGCAGAACGATCGCGACCACGACAAGCACGGCGACGACGATGATTCGCAGCAAAACGTATT
TGGCCACCGTGCCACTGCCCTTGTAGTCGTCCGCGTCGTCGTGGTCATGAGAGACAGCCGTCTCATCGACGAACGAGAGCTTGGCAGAGTCCTTGGGCGT
CTCGCTCGTTCGGTACGGCTGTTCTTGGATGGCTGCCTCCTCGTCCACCACTTCGGAGGTCGGCGCTCCGCTGTGCATGCCCAGCACGACACGTTCCAGC
ACGTAAAACACGGGGTACAGCACGACCGAGAATGCGATCGTAATGTGCATTTGCATGAAGAGGTACGCGATCACGGCGGATCCGTAGCGAGCTTTCATGC
CGAGGCTTGTGATGCCGCTGGCGTTAGGAAACACGTTGAACAGCAAGTTGCCCGAGATCTGGCAGCCCACTGCCGAGTACCCGGACCACGCCATGGCGAT
AAACAAGACCGTGATGAAGACCATGGTGATACCGACGACCTGCGGCATGCGTTCTGGCTGCTTGTGCTGGCGTTGCAATGACGGGATGACGATAGCAGCA
CCGTACGCGAGCGCCAAGTTGCCGAACGTCGTCACGACCTGCTCGAACGAGACGTCCGGTGACGGCACAGACGGATGGCCGTCCATACCGTGGATGAGCA
TGCCAATGCCAACGACGTCGGCAACGATGGTGCCAACGCACCCAGCAAAGGCCGTGCCGGCGCCTTCCTTGAGTGTCGNNNNNNNNNNCGTCAGACACAC
GGGCAGGACCATCAACGCCATTAACACGATCCAGAACGTGTTGCTGAAGGCGGTCGGAAAGAGCCCGTCGAGCAGCATACCGCCCAGCACCAGGAATGCC
GTCGGCACCAACGTACACACGAGCATCTGCGAGACCAGGACGGCGTAGCGGCCGCCACGGCCCATGCACCACTCGCCGAGGTCGCCAAACGTCTTGACCG
ACTTGGGTGCGATGAGCATGACCTTGGAAACAGCGACCGACGCGTACACGTTGGCCAGCCCCATGAAGAGCATGGCCACAATGCCCAGCGCTGGGCCTGC
ACGGGCAAAGTTGGCCGGCATGCCGAGCGTGCCGATGCCGCACACTGTGCAGAAGAGGTTGAACGCGACGATCGCGTCGTCCTTGGTGAAGAGAAACTGC
TTGAACTGCATTCTGCTTCAAGTCGCTTGGAGACGGAACGA