Description :
From Genome Similarity Track
Location :
scaffold_563:18273- 19601
Transcript NameFunction/comments
Pl_103809elongation factor 3, putative

Sequence
1328 bases(100 bases per row)
GGTGAGGCGGGTCGACTATGTAGTGGTGAAGTAAAACGAAAAATGAGAACTAACGTCTAATAGCACTACGATCTCTAATCTTGTCTGAGCGGCACCTGCA
ATATCTACGATGGTGTGTAGCGACCTCATGATCTTGTCGTGCTTCTTCTTGCTACCGGAAAAAGGAGTATCCTAAGAATACTTCCACTTAGCCCGTGTAA
CTTTTGGTTAAATCGACCGGGGTAACTTTTTTCATGTACATCTTTTCCATTTTAGTCAGCTTTGCATCGCTCCGCCACTTCTTGAACCCCGTTTTCGCTT
TGTCGAACAACGTCGATACTAGTGGGTGAAGGGTATCTCTATCTTCACCAACAGCTTGATTTTCGACAATGGCATTCGTCATCGTCACGCTCTTCTTGTT
TTGGTCTCGCAACGGTCGCTCGTTATTCTCCTCAGTACCACGATCACGGGGGAAGATGAGGTCAACACCACTGTCCTGAGGAAGTTCGGAAGTGGTTGAT
GTGGTTTTGGTGGCTAGCAGCAGAATGATTGACACCTTGAGTAAGATCCTCAGCGAATATCACATTGACGTCATTGGCATTGACAGTAGTCGGCAACTTG
TAACATGATAGGACCGGAAAGCAGTTGCAGTGTCTTCATCCAACAGTGCGATGATTGCCCAGCCAGCAAATCTTCTTTTCGGCAGTGACACCACAATGCG
TCCCTAGTTTGTCGAAACGGTAATCTGGTGATATTGGTGAAGACAACTTACACATTGGAGGATTTATTATATCATCTAAGATGAAGTGTCTGCGTTACCA
ATTCACATGAAACTCAAAAGAACGCGATCTACGTGCACATACAAAGCGTTAGCTGTCTATCGTTTTAATAGCAAGTTCAGTTTATCGCTTTCAGCCACTT
TCACTCAGGGCTCTCACGTGTGAGGCCATCCACGTAGTCGTCGAACGACACGCCCTCAGCCTTACATAGCTTGCTGAGCTTACGGATCTGCTGCTTGCTC
AGTGGACGCAGTGTCGTGGGGTTCGTCAGTTTGGGGGCTTCATGGACGAGCTGATGTTGCTGCCAACCCTTTTCTCCTCCCCAGTGTTTTTCTCGACAAC
CTTGCGCCCACCGCCAACACGGTACTCCTTCTCCTGGGTCTCACCAATGATAGTCAGACGACCAGACTCCACAAGCCACTTTTCCGTGCACAACGAGTTG
TAAAACTCCTCACTGTGGGAAACCATGATGACACTGACGAATACCGTCTGCCAAAGCACCAAGAGCAGCACGGTCCAGGTAGTTCGTCGGCTCATCCAGC
ACCAGCAAGTGCGGGCGGTTCCACATAG