Description :
From Genome Similarity Track
Location :
Scaffold_16:1826- 5495
Sequence
3669 bases(100 bases per row)
TGGAATTCCTAACGGACGAGTAATTTCTATGGTTGTCGCCCATACCGAGTCTCTTCCGTGTACGATTTCCCATAATTTATCCGACTTTACATTCACCTAC
CTCCAGTTCTAGTATCCAAATTTTTCCGGCAGCAAACATTTACCAAAGTCGATCCAGTCTGCTCTGTCCATTGCTAACGCGTCACTTGGTAGATTGGAAA
ACTCCCCAACCCTCTTGAGCTTGGAAATGTGTACGATCGGGAAACTTCCAACCCTCTTGAGCTTGGAAATATGAACGACTAAGGATAATATATAATTCGT
ACCTCGCCCTTCCAGGCTCGCCGCGTGATCCCCAGCCAGATCCAAAACTCTGAAAAGTCCATGCCAAAGGTAGACCAGTTTCTTGGCGTACCCTTCTTTA
CTCGGTCCAGGTAAAGTCATACTTGGATCACTCGTTACATTATATGATTGACTATTGCTTCGTTGTGTGCTTGCATCCCGGCTTGACTAGCTGCCCGTAC
ATCCTCGTTCACCTGTGCTTTCGCTCGCTAATGATGACTCTGAATACGATACCTCGACCTTTGAGGTCTGACTCTCGGAGTCGGGTATTCACTATCTGTA
GCTTAGCTTCGAGAGTGGTTGTAGCGTCCCAACCATGGATCAAACAGATTGGTGTCTCCTTCCGCACTATGGCTTGCGCAGTGTTAATCACGAATGTCAA
GCGCTCCGCATATTCATCCCAGTCCCGATGACCCACGTTGGAGACATATAATTCGTTAGACCTAGTCAGGGTCTGGACCATCCTTTCCGCATAACCGTAC
ACCTGAAGTCGGTAGGCCATCGTCGCTTGCTGACGTTGGCCCACCATGCGACAAAACACCCGGAAAAAGTCCTACATAAATCCTGTTCTCGATCATGGCG
GATCGCCTCACTAGCACCGAAACGGTGGAAAACACATTATTTGTATCCCTCGACTACCTTCTGAGCCGTTCGAGAAGAACTAGCCTTAGCCATCACATAT
TTGGTAAACAGATCAACCCCAAACAATAATTCTGTATTTCCCTATGCGACTTAGGAAGAGAAAGAATGTGAGTCATGGCTATTATTTGATAAGCGTACGT
GGCTTCGACGCTCCCTGGAGTCTTTACTTGTAAGGTAGCCCCCTTCCGGTCTCACTATCTTTGCAAGGTCCCACGTATCTCTGTCACTCCGGAAAAAATC
TCTTCAATGGCAATACCGACATATAAGGAGGTAGGTAAGTCCGATTCCTTGGTAACCGTCTTCCAAAATCGTATGATAATGATGAAGAAATAAGGTCTAG
AGACGTTCGGGTAATACCATTCTGCCTGCCACACCTCGGTCGTCTCCTTTGGTTTCTGGCTGGGGAAGTAAACTAGAGGTTCCTATCTGCTTATCTCGTA
GTCTCCGGACATCTTACTGCATGATCGAGTATATACAACAAACAGGTCGCTTCAGTATCCCTTCAAATATGCCTTCGAATCTCTCTCCCTGCTCTCCACT
TCTTGCGCTTCCCGGATTCGTTCCACCCGGAGTCGTGGTATCACTCCCTCTTGCATAAACACCCCAGATATTATAATAAGAGACCGTGACCGGGTCACCA
CGAATATCTTGGCAGATGGGCTCCGGTTTTAGGAACTAGCATGACAACAGATTATTCGCTTTTGAGTCTGGCCATTCTCTCTTCGGTATGGACTCGATCC
CCTTCTGTTGGCGTAAAACCGTACTGGCCAACTGGTCTGATCTGTAATTTCTGTAGCACTGCACATATAGGACTACTTACGAGGCCACGACTGGAAATTA
TTCAAAGCCTTTGCTCGTAACGGGGAAATACCCAGGGCCTTGCACTCGATCTCACCACATATCTTTCGTACGACCGAATTGGAGTCCCCACAGATGGTCA
ATTGCTGTCGTATGCAGAGGCCCCAACACGTCGAAGCTCAGCAATATGCCCTCATATTCAGCCTCATTCACTGTAGACGCAGCGAGGTACTTCGAGGCAG
CCTCGAATATAGTCCATATGAGGAGCCTCGATACAATAACGCTGCAGGCTCCACCTCCTTGTTTCATCCAAGCCGACCCATTAAAAATCATTTCATACAG
GTTTTTGTTGGGTTTAACTATGAGCGTAGGTACGTCGATCGTTTGTCGTGCCTGTTTCTTAGGAATTTATGACAACAAAATCGAGCCCACACTTTCTCGA
GGGATAATTCCGGGCGCCAACACTCCTAGCACCTGTTCTTCGCATTTATTACACTTCACGATCTCTAAAGTTCACTGGAACAAGAGGGCGATCCAGTTTC
CTAGGCGTCCCTGCAAATCGGCAGATTTTACTAACCATACCAATGTCGGATGTATCGTCAGGACTGTGAGGTGTCGGGTAACCGACATCGTATATCAAGT
TTCCAGTATTCTCAATAATGCTAAAAATTTTGTATCCACAGTACAGTAGTTTATTCATTCACCTTAAGGTTCGGCCTGTAAAGGTTACAGGCATAAGATC
ACCTTCATGATTTTGTACCAATGATACCGATATAGCCCACTCACTCACATAGACGATAATCACTGCTTCTTTGGCCGGTCGAAATGTCGAGGAATGAGCG
GTGTAGCAATCTTATTCTTGAGCATGGCGAAAGCTACTTGAACTCGAGACCATATTCTCTCGTCTTCCTCCTTGGTCGTCGCACGACCATTAATTATTAA
CTTGCACTGCCATGCGTGGGAATCTACCTAACCTCTTAGAGGATCGACGCATACACGGCATAGTCTTCAATGAATCTACTATAATAGTTTAGACTTGCAA
GAAACAATTGCATAGCTTTCAGTGTCGTCGGCAAGGGTAAATCCACCAAAGACTGAAGGTATTTCGGGTGGGACTCTAGTGGGGTGCCGGATCGCGCTGA
TTAAAATTCCAATAGTCGCACACATTTAACAATCGATCTACATTATTGCATAACATATTCCACGACTCGGCCGGAATTAACATGTCGTCTATGTGCGACC
GTCGACTAAATATCGAGTGACCCAACTTTACATCTGGTTCTCCCGTCGCGAACAGATCCTTGATTCATCTGGATGTCTCCACGAGAAATTCATAAAAATC
CAGATAAAGCCTTATCCAACAGTCACTGGTATATCTGAGGCGCATTCTTAAGCCCAAATGGCATCTGAAGCCATTCATATAATCGAAACGGGGTGACCAA
GGCCGAGATCCGTCTCGCCCTTTCGGTCATGCCGACAACCCAAATCAATTGCCATGTCAAGAGAACAATACCACAATGCCCTATCCATATTCGCCAATAA
TATTAGTCAGTGGCATAGGGTAGACCGTGAGTTGGGTTAAGTCATTCACCAACCGGTAGTCGATGTCCAAACTGATGTCTACCCTATTAATCATCGCGGT
AATCACAATTGGGTAGCCCTTGGAGAGGTAGAGGGTTGGATAATCTTTGCTGATAGCAGTCCCTTCATCAGGTCGGCAGTTTTTCTTTAAACTGAGTGCC
ACTTTGCGTACACGCTGTGCAATCGGCCTTGTATTCCCAACATCGATGTCACATATAGCCCTCGGCCAGCTGGTGGTAGGGCGTTATCCTTCCCTATCAA
CAGATGTCGTTTTTACATAAAATCTGTTGCAACCGGTCCAGATCTTCCGGAGTATTCCTATTCGGATCA