Description :
From Genome Similarity Track
Location :
scaffold_1635:1826- 3301
Transcript NameFunction/comments
Pl_100467reverse transcriptase

Sequence
1475 bases(100 bases per row)
TCGACCACTAGCCCTTCTTTATTCTTTAATGATAGGTGACTGGGCATTTGGCGGACAGGCGATCACACTCGGGCTTCCTCTTCTTTAATGATAGGTGACT
GGGGATTTGTCGGACAGGCGATCACACTCGGGCTTCCTGTCCAAAGGATCGCGTCAATACAACGAGAGAATCTAGCATACAAAGCCACAACAGACAAGCA
AGAAGAGGAAGTTGCCCACTGAGCCGATGGTCAGTCATCCTCAGTTCAACCTGCCGACTCGAATCCTGCCCCTCCATGAAGCCTGCCGTCGCGCAAATGA
CAGTTCGGGTGAAAGATCCAACACAAGGTTCGGTGGAGGGAATACATGAACTCAATTACGAGATCGCAGCGCCGCACGAAGCTGAGACGCGTTCAGAATA
TGGTGATGTTGAGGCTAGAATTAATGAAGTAAATCAAATTTGCAACCACGAAGGTGGTGACTTGTTCATAGAAGGCATCGAGGACCTAACGACCGTGTTG
CCGGAAGTGAGAGCGACCACCGTAGAGGTCATCCAAGTCAGAGATGCGGAGGTGAACACATCGGATGAGATCGAACAACTACGCCGCATCATCTGGAAAC
CAGCCCACCTCATCATCGAAAAAGGCAATACGATCCCTCCATGAAATACCTGTGATATCGACGTAGAAGATTCGACACCAATGGCGCAACACTGTCGACC
CTTTTTCGGTCGATCACAACATAGGCACTTGTTCTTAATGAAGCAAATTCAGTACTAATTTAGGGTTAAGGCCTATCCCATCGTCAATCCTAACCTTTAT
GACACACCAACTGCGTGCAATATCTTGATAGTTGTATTGTCATGCCTCCTATCGTCGCAGCTGCTATCTTGTCGGATCATGCCAGATCTGGTCCGTCATC
TTCAGACCTAGACCTTGCATCACATCTTCTCCAATGTAACTTTTCCGACACCAAGATCCCAGATCACACCCATCTGACCTCTGGTCATCATTCCATTAGG
TTCCATCAGCCTAGATTGCGGATCTTCCACCTTGGATCCGGATCTTCGGATCTAGATATGATATCATCTAGATTTTAGATCTCTTTCTTGGAGCTATATC
GCCGGACCCAGATCACAGAACACCTGGATCCTAGATCACTTGGATCCTAGTCAGATCCGTAGTCCTAGATCCTGGATTCAAGTATCCGTATTTTTGATTG
ATCTGGTTGATGATCGGGCCTCCAATCGCCACTTTCACCACTATTATAAGGACCTTGCCTGCAGATTTTTGAAGCCCACTTCACCACACAAAGTAGACGA
CACATCCATGAACAACTCTCAAGTAGATCAAGGTATATCTTCCTCGCGGACATGTGAAGAATCCCCCGCGCGACCGAGTACCGTCAATACGGCTCCACGT
GATCACCCCACCAAGGCATCTTCACGTCACCGGAAGAGAGCATTCCACCCCACTGACAGCTACACAAGGTGAGAT