Description :
From Genome Similarity Track
Location :
Scaffold_288:18259- 19414
Transcript NameFunction/comments
Phyke_g7841serine/threonine protein kinase

Sequence
1155 bases(100 bases per row)
TAGTAGCTTCCGCTCATTCGCGAAGCTGACACAGCAGTTCTCCCCCCCCGGGGAGGAGGTCATGCACCAGTTCGTTATCAATGGTGTGCGCTACCAATTA
GCAGAGAAGTACCGCATGGTGAAGATTGTGGGCAAGGGCACTTACGGCGAGGTGATCGCCGCGAGTGACTTCGTGCACGGCGGGACATTCGCGATCAAGA
AGTTGGGTCAATTTCTGCGCCACCCGAAGGTGGCTTTATTGGCGTTGCGAGAAATTAAGCTTATGAGTGAGATTGGTACACACCCGTGTCTTATGGGCTt
tcacgagctgcagcgaccGCTGGACTACGAACACTTTGAAGACCTGTATATCATCCAGCCTCTCATGGAGACAGACCTGTGTCGTATTATCCATTCAAAG
GAGAATTTGAACGATGACCAAGTGCAGTACTTCTTGTATCAGATGCTGTGCGGCATTCACTACCTGCACTCAGCCGATGTGCTCCACCGTGACATCAAAC
CGAGTAACATCCTCGTGAACTCGGACTGCCGGATCAAGATCTGTGACTTTGGACTTGCACGACATGCCAACGATCACGATTTAGCGGAAGGCCTTTCAGA
ATATGTGGTCACACGCTGGTACCGCGCCCCAGAGCTATTGCTGGCAAATGCATACACAAAAGCCATCGACATGTGGTCTATCGGCTGCATTTTcgctgag
ctgctgggcCGGCGCATCATGTTCCCTGGTACATCGTACGTGGACCAGCTCAAGGTGATTGTAGACATTGTGGGCACACCCACGACCTTCAGCTTTTGCG
ATAATCCTGTGGCGCGTCGCTACGCTGGGCGTCAGTTTCTAATCCAGAGCCAAAAGGTACCCAAGGTGGACTGGGCAGAGGTCTTCCCGGAGGCCAACCC
AGACGGACTAGATTTGCTGGACCGCCTGCTTCAGTTTGACCCAGCTAAGCGCATCACGGCGGCCGAGGCGCTGGAGCACCCGTACGTGAGCCAATGGCGT
GACGCTCAGCTGGAGCAACCGTGTCATGCCGATGTGGCGACAAACCTTACGCAATTCGACTACGAGCAGGTGTCGTACGACCCGCAGACACTCAAGGAAC
TGCTGTACCAGGAGGTCATGAAGGCGCAGCATCCACCCTCGCAGCAGTCCATCGC