Description :
From Genome Similarity Track
Location :
contig_7:182575- 184733
Transcript NameFunction/comments
g2013.t1hypothetical protein L916_00379

Sequence
2158 bases(100 bases per row)
CCACCACCCCTAGAGATGGAGGTGTTGTATTGCTAACCGCCCTTCGCAACCCACCCGCTTCCGGGTGAGGAAGAACCCGCTGATAAATACTTCGCATTTG
ATAGTAGAGTACGAAAATATCGCGGAGCAATATGCGTGAACCCAGCTCGGGTTCCACGATGGAACAAACCATTTCGAAAAACTCCCCTGAACTTAGCCAG
TGGCGATCATTATCCAGAAAATCAGCAAGGCAATGCTTGTTTGCCTTCGCGAGAGCCCGACACAGATTTCGAAACTTGACAGACCCTGCTCCTAGCGGCA
CCGACGTTGCCACTTGAAAATCTTGGCACTTGCTCCACCAAATTGGATTATAAAGAGCGTATTTCAGTACTTGAACTCGACTTGTTGAAAGCAATCTTCG
GTCAGGCCACTGTAACCGATTCCACTCACGTAGTAGTTGACGCCACCAGACAGGTAGCATCGTTGCCTTCCATCTTGATGGTCTTGGGGGATCCTGAAAC
AAGAAACCACTTGATCCTGGCCTCCAAAAGGGCCCATATCGTTTTCCCAGCATGGCTATCAGCGGACGATACCACACAGTATCTCCTGAGCTCCGAGGGT
GACCCTCAAATGCTTGTACGACTTGTAAACTGACGATCCTCCACATGGATGGCTCTCCGATAACCCTATTGCTTACGTCCGATTCGCATCTAGTGTGGAT
TACAGTAAGCGCTCTCTGTTCTGGTACCACTTATAAATAATACCCCGAATCGTCTGATAGAATCGTTTTAGACAGGTGACACAGCTTCACTTATGGCGGG
AATCGCCACGCACCATTCATCTCAGCCGCGCCACACATCACAACACAAGCACTTCCTCGCACGCCCATGGATGAAGATAGAGCAGAAGAGAGGTCTTATC
AAGAAGGCACGCGAGTGTCCGGCGATGACCCAGGTGGCGCTCTCCGCCTGGGCCAAAGTTACCTACAAGCTGAAGCGGGCGCCAGCTCAAACAATCATTT
CCGACATCCCAAGATGGCCCCGACAATCATGAGCAAGGCGTATGGGGACGGCAAGCGGCGCAAACCGCTGAAGGAGACCTCTGAGGCGCTGGAAGAGCGC
CTATGGGAGTGGATACAGAAAGCAGAGGCGCTGAACGTGTGTCTTTCTCGGGAGCTGATCAAAATGAAAGCGCGAGATTTACAAAAGAGCTATGTGATGC
TTGGGAGCTGTCCTTTTCGGACGGGTGGCTCACTGCGTTCGAGCGCAGGCATGGTCTTCGTCTCGCTCACGACCTGGAGAAGCTGCATCGGTCGACCCTG
AAGTCGTTCGCGTTGGCCAACGGCTTCAGGAATTGACGGATCTATACTCTCCCGAAGACGTCTACAATATGGACGAGACGGGCTGTGCTACGCAATGGCC
CCCGCTCGATCGATCTGCACAAAGACAGCGCGTGGTGTGAAGAAGAAGAAGACGCGGATTACTCTCGCGCTTACGGCAATGCTGATGGATCCGACACGCT
GCCGGCACTCTTTTTGGTCACGCAAAGCAGCCCTACTGTTTCAACAAAAGCACGGCGGCACAACTAGGCTTCTTGTATCCGCTCGAACAAGAAAGCCTGG
ATGACAGGACTACTGTTCCGGGAGTGGCTTCTCGATCTGGATCGCGACATGCTCGCGAAGGGCCGTCAGATCCTATTGCTGCTTGACAACGCATCGTCCC
ACCATTGGCGATATCGTGTGTACTAACGTCCGCGTAGAGTTCCTGCCACCGAATACCACGGCATTCCTACAACCCATGGACGCAGGAATCATCGCCGCGT
TCAAGCGCGCGTACAGGGGAAAGCAGCTTCGTTGGGCGTACGAGAAGGTCAAGCGTGGTGAAGAGCTAAAGAAGGACGTTTACACTGTCGACCAGCTACA
GGCAATGCAATGGAGCAAGGAGATCTGGCTCGAACTGCAGGTAAGCCCACCATTCAAACTGTTTCCACCACACTGGAATAGTGTTTAATGCTGTAGCTGA
GAGGGACAAGGAGGACACTAGCTATGGAACCGACGTTGATCTGGAGGATATCATCATTTGAGCTTCACAGTTGAGTATTTAAGTAGCCGACGATAATGCA
TAGCAAATCTTAGAATATGGTCGGACCACGATACCGGAGGTGGGAGCATATGCTGTAC