Description :
From Genome Similarity Track
Location :
Scaffold_432:18256- 22358
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_432-abinit-gene-0.21Voltage-gated Ion Channel (VIC) Superfamily
Pytul_var.sporangiiferummaker-pug3_contig_432-snap-gene-0.16Voltage-gated Ion Channel (VIC) Superfamily

Sequence
4102 bases(100 bases per row)
TGCTGCTCTCTTCAGCAAAGAATTCACTCGAAGGGTTCTTCTGTCGCACAACGTCCTGCGCGAGTTTGAACACGACCTGAAAGTACGCATGCGACTTGAC
TGCCTCCAGAAGGTCCTGCGAATTGAGCACAAACAAATCGCTCGCACGGATTGTCGAGACCGTCATCAAACTCACCGACTGGCCCAGAAGCCCCTTCTCA
CCAAAGTAGTCGCCCATACGGAAGCGACTCGCATGGTAGAGCGACGGATTCGACGCGCTTTTCGAAAACAGGTACCCACGCACAACGAAATACATCGCTT
TGCACACACTTCCCTCGACGATCACGTCTTCGCCGCGAGGGTATCCTTCAAAGCGCAGTGAGTGCGCGATCGTGTGCATCAAACTATCGACTGTAGCACT
GCCAGTCTCATCCTTGCTCGCACCACGCGTCAGCGGCCGAAACACGCGCTCCGTGAACAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGCGTCT
CTGCGATGTATGAGATCCCTTCGGCTCGCACACTTGCTGGTAAATCGTCAAATACTGCCTGATAGTCCACACCAGCGTAAGAGGACCACCACGACGACAG
AAACGCATTGGCGCGCAGTTTCAACGGGTTGCTGACTTTCCAGCGCGCCAAGTAGTGCTCGATCGCGATGTGGTTTTTCCGATATTGCACTTCGTTGTCA
ATGTACAGGATGAACACATTCGCCATCTGACCGATCATCAGCGCCATGATCAATTGGCCTACAAAGCAGATAAGAATGCTGAACACATAGTCCAACGTGG
TCGTCGGGACAAACGTTTTCCCTTTTTTCACGAATGCGGTCGTCGCGAAGAAAAGGCCGCGAAACAAGCGTAGCAGCAGCAAACCAGGCTCGGGGTCGGG
AGAAGAAAGCTGCTCGTCGGGCAGCCAGGCTTGCCATACGTTGCCAAAGCCATCGTGCATGGACACTGCAAAGTAGGCGCACGAGGTCCAGAAGATGGCC
AGCAAGTAGAGCAGCCACAGCGTCTTGACTTTGTCCGCTTCAAAGGACACGCTGCGTCGATTGATTTCATTCCGGTAGTACGCGAGATTTCGAACTTTGA
AGCATCGATTCAGTCGAAGCCACTTTTGAAGAACCACACGCTGCTTGCTGAACACAAAATCTACAACAAAATGGTCGATTGGGAACGCCGCCACGAGGTC
CCAGACGAGCCGTTCCCGCTTGTACGCCAGCAAGTGGTCTTGCTCGTAGAGCTCCATTGCAGTCTGGTTCGTTCGCACACGGAAGTGGAACCAGATATCC
CACCAGTACACGAACTCGCAGAAGCACTCGACGATGCGCAGGAGCACTGGGATGCCATTCCAGCGATCCATATCATCGTACGCAACACGGTAGGGTGCAA
ACACAGCCGTGAACACTGTACAGAACGTTGCCAATCGAAGCCAGAAAATGTAAAAAGAACTCTGGATCTCAGCACCATTTGCAAGCAATTGCAGGAAGCT
CTGCACCTTTTGAGTGATTAGTTTGAGCCTCGCATGCAACCGCGGGAGTATGCCAGACTTTAGAAAAAGTTGCTGGATGGAAAACGTGAGAGATTTCTTC
TTGCCACCCCGGGAATGCGCGAGAAGCAGCTCCTCGATTCCCTCCGCACGGGAATTCATCAAATCCATCCGCGACACCTTTTGCTTGAATATTCGTCGAC
GTCCTCCACCATCTATTTCTTGCTGTACTTCCGCAGCGAGTCGAGCCAAGCGCTGCTGCTCTTGCTGAATCTTGACAATCCGCAAAACTTTCTTCTTCCA
TTCGGGGTAGCGATCAAATACCAACTCAAGAGATTCCCGAGACAATTTGTACAGGATGCATGAAGTTTTGGCTTTGACAAAAGCATTCCGAGGCGCATTC
GTGAAAAGAGCAGCTTCTCCGAAATAGCTTCCTGCTGTGATTTCATTGACTTTCTGCAAGGCTTCGACGCTGTTGCTACGCGAGGTACTTGCTCCCTTTT
GAGATGGAGTAGAACTTGCGGGTGGCGTCGGTGGACCAGCTCCAGTAAGCAACGATACTGGAATTAATATATCAAGCATCCCTGTGAAAATGAAAAACAT
CTCACTGCCCTCTTCGCCAAACCGACAAATGTACTCGTCTTTGACAAACATGATCTGGGTAAAGAGAGATATGAGCATCCTCGTAACCGAATCTTCCATT
CCAGTGAGGAATGCGACCTTGACAATCATTGGCTGAAGTTGAAACATCCGAATGTCGACAAGCAGCGATGGCGGCAGCACTCGCTCCAGTACGTGCTCTN
NNNNNNNNNNNNNNNNNNNNNNNNNGTAATCGAGTGGAACCGCTTGAAAAAAAAGTACGTCTTGAACTTTTCGGAAATATGCTGCGGGAGCTTGAAGTGG
CCGAGCAATTGGCGAAGCGCACTGAGCTTCGCGACAAAATCTCTATTTTCCGAATCTTCCAGCTCGATCACATCCCAGAAGTTGCCAATGACGTAAGCGA
AGAGGAAAAAACCACTCGTCATCGTGCAGACACTGAAAAAACACTGGGCGACCGTCTTTGGTAACTCACCTGGACTCGACGCAGACATTAGACCAAATGC
CCAAAAGATAGATCCGAAGTACTGGAAGCTTCGATTGGCACCGACAAAGTTCTCTCCTGGTAACCACGCGTTCGCGCCAAAGTACGTTGTCAATGTCGCA
TTCGCGTGCGCAGAAGACTCAACACCAAAGTGGAGGCCGGACGAGTTTGCAGCGAAGTCAAACCAAATGCAGCCGAAAAAATGGAATGTAAGAAAGGTGT
AATACACCAACTTGAAAAGCCTCAATTCGAGCGTTAGCTTGACATACTTACTTTCGAGGGACTTAAACAGCGTCGGAGCTTTCACAATCCGCAGCAACTT
GTTCCAGTTCAGTAATTCGGCTCTGCCCTGCACCGTGGAGGGTAACCAATTCAGCGTGAACAGTGGGACCAGTGCCACAAGATCCACATAAAAGTGTGAT
GTGTGAAGATAATGCTTCTTGATCAGTTGAATGTCCATCACCTTGTTACCATACTCGTAGTACCCGAGGCGAAATTGAAGATACATGTCGATCAAAAAAC
AACTTTCCAGCAGAATCGTGACGGTATCAGCGGCCACGAATACCGATGAATCGTCCGTCACATATACGCCAAAGCAAGTGTGGTAGATCACGAGCACACA
TTGCGCAGTCGTTGCAAAGAATATCCACATCTCCCACATACTGACAAACTTGGAGTCGGGATCGAAACACGCTTGGTTTCCCCAAAACCCCATTCCCTTC
GATATCACTGTCAAGGGCTCCGTAGCCTTCGCTCCCATCATAGCCCGCCGTAAAGTAGGAGAAGATGCCGGTGGTCCCGTGAGGACTTGTTCAAGCAACG
ACGTGCGTGCCACATTGGCGCTTCGAATCTTTCGCTCCAGTACACGAAGCGACACTGAGAGGGACGGAAACACCTTTTTCATCACCAGTAGATGCTCGCG
CGACACATATACAACAATGCACCCGCTTATAGCAGTAACATGCTCAGTGTATCCGATCGCCAGCGTCTCAGCTTCTCTCCCCATGTCTTCGTGTAGATCC
AATGCAGCGGTCCCAAAGAATCCACCAAGTGGCACGCTGTGCGGCATGCCGCCATCAGACATCACAGAGACACGCCCTTCAAGCACAAAATACAATCCGG
CCGCGTAGTCGCCTAGACGATAGATGATCTCTCCTTGGCCGAAAAGAATAAACCGCAAGTTATCCAAGAAGATCGATTCCATCTCCGAGTGCACATCATC
TGGGATCATATTTGAGGTGCCAATTTTATATGGATCTTCAATTCGAAGCAGATTGAATGATTCTATAGCAGGAGTGCAGATACTTCGAACAATGTCCCGC
TTTATAGCTGCCGGCAGTTCCTCAAGCAACTCGTGGATGATGGCGCCACGGTGAGACGACCACCAGAAATCCAAAAATGAGTTTACGCGCTGATGAATCG
ATAGTGGAGAATTTTGGCGTTTCAAGAAGAGCTGGATCCGCGAGCGAGTTGCAAAAAACTCTTTTTGCTCGAACGCCGAAGCCGTGAATCGCTTCTGAAC
GT