Description :
From Genome Similarity Track
Location :
contig_59:18254- 20416
Transcript NameFunction/comments
g11027.t1hypothetical protein

Sequence
2162 bases(100 bases per row)
ACGAGACCATCGCCCTGGGCGACGACATGCTCTGCTGCACCGAGTCCCAGTACACGGGCCTGTCCACGCAGGTCCGCATGATCCCGGGCCTGTGCTCGGC
CTGCAAGGAAAACCTGCGCAACATTTTCTGCCAGTTCACGTGCAGCCCCAACAACAGCCTCTTCCTCAACATCGACGAGGTGCGCATCATGTCGGGCGAC
GACGAGCACGAGGGTCAGATCTTCCCCGCCGTGGAGGAAGCCACGTACTACGTGGGCAAGGACTGGATCCGAGACATCTACGACTTCTGCGAGGACGACA
GCTCCTTCTCGCTGCTGTGCAACCCCAACCAGGACTGCACGGACGGCTACGGCCTCATGGAGTACATGGGCAAGTACGCGTACAACAGCATCGGGTCTCC
CGAGCAGATCAACGTGACGACCATGGACCAGTACTCGGAGGAGATTCAGATGACCGAGTTCTGCCACTGCGACGCCAACGCGACCAACTGCATTTCGCCC
ATGAACAACAAAATGACGTCCTGCGTGGGCGTCTGTGGCTCGCTCTGTGCCGTAAGCTCGGACGATACCCGAACGTACACCGACGCCTGCTACGGCGCTT
CGTCCGCCTCGTCTTCAGGTAGTGGCAGCGTGGTGAATAACAACGACGACTCGACCTGGGCCGAGCTGAACGAGTACCTGGCCACCAACATCCCGGTGAC
GGACTGGACAGCGCTCAACTACTTCCTCGTCATCTTCGGTGGAGTCGTGGGCTTGTTGCTGATCGTGGGGTTCATTGTCGCCATGCTTCGCGAGCGGAGA
TATAGCGCGGTAGACCACGCTCAGACACCCCCAATTGGGGCTGTTACGCCAGACTTCCATGGTGTGGCTAGTGCGATGGCTGGAAGCGTTGTGCACTTGA
GCTTCATGGATGAACTCATGACGAACAAGTTGCGTGCGTGGGCGCAATTCGTGTCGAAGGGCAACCGACCCAAGAAGATCATGCCGATGGTGCTGGTTGT
CGTCGTGATCTGTGCTGCCGGTTTGTACAACATTGACATCGAGACTGACCCGATCAAGCTGTGGGTGTCCACGGCTAGTACGTCCTATGAGCAGCGCCAG
CACTACGGAGACATTTTCAACCCCTTCTACCGCTCGGAGCAGGTCATTATGGTGCCCAAGGACGGCGGCAACATCTACCGCTCGTCGATTTTGAAGGAGG
CCATCCGCGTCCAGAATGTGGCGGCCAATGTGACGTACACTTCTGATGATGGCGAGACCACCATCGAGCTGGATGACATTTGCTGGAAGGCCACGGGCAC
GGGCTGCACCGTCAACTCCATCACGCAGTACTTCCAGAACAACATGGAGCACTTTGAGTTCTACGAGAAGTACGGCTTTGAGCTGGAGCACTTCAGCAAC
TGCTTGTACTCTCCGACGACGTCCGACGTGGCACTTTGCACGGAGCTGAAGAACGCGTTGGACGATGGCGACTCGCTTCCCTCAAGCATGAGCGATTGTC
CGTGCTTGTCGGCATTCGGCTCGCCTATGAACCTCTACAACACGTACCTGGGTGGTTTCCCCGACGGCGCTGAGAGCAACTATACCTTGTTCCTTGACTC
AGTGGCGTTTGTCTCTTCGTACCTGAACTACAACTACGCTGATGACGACAAGAACGACGCTGCCATCAAGTGGGAGCGCGAGTACATCAAGACGATGAAG
GTGGAGGCTGCTTCGAACACGGTGTTTGACGTCTACTTCTACGCGGAGATTTCTGTCAATGACGAGGTTGACGCTGAGTCGAGCAATGGTATGGGCCCCG
TGGCGTTGAGTTACTGCCTGATGCTGATCTACATTTCGCTGGGTATCAATCGTTTCAAGTTCAGTCGAGAGTTCTTCATCTCGTCCAAGATCGTGGCTGG
CTTCTGTGGCGTGATCAGCATTGCGTGTGGCGTCGCGTCGACGGTCGGTCTGTACATGTGGTTCGGAGTCAAGCTGCAGCTGATCATCATGGAGGTGGTC
CCCTTCCTGTCGCTGGCTATCGGTGTCGACAACATTTTCTTGCTCATCCACGCTATGACCGAGAAGGAAGACCAACTCCGACGAGATCAGCCGAGTCTCT
TCATTGGTCTGGAGCACAACCCGAAGGCCATCGAGGAGATCACTACTGTCATCGTGTCCGAA