Description :
From Genome Similarity Track
Location :
Scaffold_51:182531- 185113
Sequence
2582 bases(100 bases per row)
CCTCAGACGTTAACTTCGGAGATCTATAAATTTCCCACGCTGGAACATAAGAGGTTCTTGCGTGATCTGCGTAGTGGTAAAGTCAAACGGACCAGCGTAC
TTGTCGCGGAAAACGAGTAAGTCACCGATTTCGGTCGGAAATGGTCTTTGTCGAGGATAAAAGAGTTCTCAGCAGCTCATCAATGGACGAGAGTGCCTTT
GATGAGAAGACTCATATTGAGCGATATCCATCCCAATCGTGGGAATCACTCAAGGCAAATCCTCTTTACGATGATTTAATAGAATTCATAGATGTATTAC
CAGAAGCCGTGCCGTGCGAGTTACCTAATGATAAAGGTAATCGTCACGAAATCAAACTGAAAACTGGTTTCAAGTCTTGTGTCATGAAGCAGTGGCCAAT
GCATCAAGAACAAGTACTAATGATCGATAAATTCTTTTCGCACCGCTTATCAGCCGGCCATGTGAGGGAGTCGACCTCTCCACAAAGCTCTCCGACCTTC
TGTGTGCGAAAAACCACAGTAGGATGGTGAATAGTGCATGCATTTTGCAAGTTAATTGCTGCAACGGTATCGCCTACAACGCCCATACCTAGGAAAGATG
TTATTATAGATGTTATGGCAAAGAACTTCATGTTTTCATCAATGGTTCTGATGGATGGATTTTATCAAATACTTATGCATACATCCCGTATACCGCATTT
GAGCACTCCAAGCGGTATGCTCTGGGAGTTGCTGGTGATGCCATAAGGACTAAGCAATGCCCCTGATACATTCAACAGATGTGTGACAAACTGTTGCGAT
CCGTACGAGACTTCTCCGATGGTGTGTTCGTCTGTAGACGGGCTATGGACGGGCATGTGGATGTGGAAGTGCACCGACTCCGCGTCCAAAAGGTTCGTAC
ACTTATGCGCAAACACAAGTTGTATGCCGACTTCAAGAAGTGTATATTTGCTGCTAGCGAAAAACCACTTTTAGGGTGCATAGCGGGTAAACATAACGTA
CTGTCCGACCCGGAAAAGATCAAGGCGATCACACAATGGGCGGTATACCGATGAAAAAAAGACTTCGGAATTTCCTTGATTTAAAGGCGTATTTGCACAA
GTATTTCTATAATTACGCCTACATGACTGTTCATCTCTCTCATTTAATAAAAAGAACCAAAAGTGGGTATATATTGCCGACTATCAGCGCTCCTTCGAAA
GTATAACGTCAGCTTGATACGATCGCCATTTTTAGCAATTGCGGACCAAGGCAGGTCATTTCATGTGGTCTGTGATGCCAGGGATTTCTCAAATCGGCTG
TTCTTTAATGCAGTACAATGCAGACGATGTGGAACGCGTCGTCTACTATCAGTCGCGTCAGCTTCAACCAGCTAAACGTAACTACCCTGTCCATGAAAAG
GATCGTCTTGCCATGAAGTACGGGTTGGAGAAGGTCAGGTTATACCTATTAGGTGATGGACCTGTTATCGTCAATACAGACCATGCGACGTTACGCGACC
GTAAACAGTCCACATCTCTCTCAACAAATGGCAAGAAGGGTGTCATCTTCGCGGAGTATAACATTTCCGTCGAGTAAAAGCCAGGACGACTTAGTGTTGT
CGTTGATGCAATCTTGCACCGGCCTGATTTCGAATCGGCTGCGCAACCTGACACTGGTGTAATTACAGTCGAGGTCTTGACCTCAAGTGTCCCGTCACCA
ACCTTTCTGGAAGGCATAAGAAAGGCGCATGATATTGTGAGCTTGATAAATAATCTCTCGCAACATTCCAAAAACCATTTACCAATCGTCGACAGTTTAC
CGATCCTCAACGGATATATATACAGATTGCAACGGCTTTACTGCACTATTCATCTGTCGCCGGCGACACGCCTCGCGTCGTCATACACAATCATGGTGAT
CTGTGATTGCAGATTATGTATAAATAGCATGACGCACCTGTTGGTGGGCATCGTGATAGTGAGAAGATATTTCTCACGGTGAGCCGAGACGTTTACTGGT
CTCTCCAATATTAGTTTGTGCGCAAGTACGGTCGGGCCTGCGAGGTCTCACAACGGCGAATTCTAGTCCTTCCCTTCGCACCCGTTGCAGCCTCTCCCTG
TCCTGGCTGAGTGCTGTGAAATGTCTCAATGGACTTTGTCTTTAGATTCCCCGCAGACTCTCACAGGAATACTGGTATGCTTGTGTTCGTTGACAGATTG
AGCAAGATGGGTACACCTGGTTGCTGTACCTGAATCAATCAACGCATCGAGATGTGCTAGTGTCTTTATTGACACAATCTTCCGCATTCATGGGCCAACT
CGTGAACTCGTGTCCAATCGGGACCCGCGATACGGCTGAGTTCTGGCGATCCGTGTTTAAAACACTCGGAAAGCGCTTAAAAATGTTCACATCTGACCAC
CCTTAAACGGATGATCAGACGGAAAGCGCCAACCTTATTCTGGAAGAGATCCTTCGAGGATACGTCCATTCATTTACGAATAGGAGCGAAATATTGCCAA
TGGTACAATTTGCGATCAACAACTCGGTACACGCGTCAATGACGCATACGCCGTTCTTCGTGAATGGGATACGTCATTCGCG