Description :
From Genome Similarity Track
Location :
contig_59:18252- 20583
Transcript NameFunction/comments
g8957.t1resistanceNodulationCell Division (RND) superfamily putative

Sequence
2331 bases(100 bases per row)
GCCCTGGGCGACGACATGCTCTGCTGCACCGAGTCCCAGTACACGGGCCTGTCCACGCAGGTCCGCATGATCCCGGGCCTGTGCTCGGCCTGCAAGGAAA
ACCTGCGCAACATTTTCTGCCAGTTCACGTGCAGCCCCAACAACAGCCTCTTCCTCAACATCGACGAGGTGCGCATCATGTCGGGCGACGACGAGCACGA
GGTCAGATCTTCCCCGCCGTGGAGGAAGCCACGTACTACGTGGGCAAGGACTGGATCCGAGACATCTACGACTTCTGCGAGGACGACAGCTCCTTCTCGC
TGCTGTGCAACCCCAACCAGGACTGCACGGACGGCTACGGCCTCATGGAGTACATGGGCAAGTACGCGTACAACAGCATCGGGTCTCCCGAGCAGATCAA
CGTGACGACCATGGACCAGTACTCGGAGGAGATTCAGATGACCGAGTTCTGCCACTGCGACGCCAACGCGACCAACTGCATTTCGCCCATGAACAACAAA
ATGACGTCCTGCGTGGGCGTCTGTGGCTCGCTCTGTGCCGTAAGCTCGGACGATACCCGAACGTACACCGACGCCTGCTACGGCGCTTCGTCCGCCTCGT
CTTCAGGTAGTGGCAGCGTGGTGAATAACAACGACGACTCGACCTGGGCCGAGCTGAACGAGTACCTGGCCACCAACATCCCGGTGACGGACTGGACAGC
GCTCAACTACTTCCTCGTCATCTTCGGTGGAGTCGTGGGCTTGTTGCTGATCGTGGGGTTCATTGTCGCCATGCTTCGCGAGCGGAGATATAGCGCGGTA
GACCACGCTCAGACACCCCCAATTGGGGCTGTTACGCCAGACTTCCATGGTGTGGCTAGTGCGATGGCTGGAAGCGTTGTGCACTTGAGCTTCATGGATG
AACTCATGACGAACAAGTTGCGTGCGTGGGCGCAATTCGTGTCGAAGGGCAACCGACCCAAGAAGATCATGCCGATGGTGCTGGTTGTCGTCGTGATCTG
TGCTGCCGGTTTGTACAACATTGACATCGAGACTGACCCGATCAAGCTGTGGGTGTCCACGGCTAGTACGTCCTATGAGCAGCGCCAGCACTACGGAGAC
ATTTTCAACCCCTTCTACCGCTCGGAGCAGGTCATTATGGTGCCCAAGGACGGCGGCAACATCTACCGCTCGTCGATTTTGAAGGAGGCCATCCGCGTCC
AGAATGTGGCGGCCAATGTGACGTACACTTCTGATGATGGCGAGACCACCATCGAGCTGGATGACATTTGCTGGAAGGCCACGGGCACGGGCTGCACCGT
CAACTCCATCACGCAGTACTTCCAGAACAACATGGAGCACTTTGAGTTCTACGAGAAGTACGGCTTTGAGCTGGAGCACTTCAGCAACTGCTTGTACTCT
CCGACGACGTCCGACGTGGCACTTTGCACGGAGCTGAAGAACGCGTTGGACGATGGCGACTCGCTTCCCTCAAGCATGAGCGATTGTCCGTGCTTGTCGG
CATTCGGCTCGCCTATGAACCTCTACAACACGTACCTGGGTGGTTTCCCCGACGGTGCTGAGAGCAACTATACCTTGTTCCTTGACTCAGTGGCGTTTGT
CTCTTCGTACCTGAACTACAACTACGCTGATGACGACAAGAACGACGCTGCCATCAAGTGGGAGCGCGAGTACATCAAGACGATGAAGGTGGAGGCTGCT
TCGAACACGGTGTTTGACGTCTACTTCTACGCGGAGATTTCTGTCAATGACGAGGTTGACGCTGAGTCGAGCAATGGTATGGGCCCCGTGGCGTTGAGTT
ACTGCCTGATGCTGATCTACATTTCGCTCGGGTATCAATCGTTTCAAGTTCAGTCGAGAGTTCTTCATCTCGTCCAAGATCGTGGCTGGCTTTGTGGCGT
GATCAGCATTGCGTGTGTGTCGCGTCGACGGTCGGTCTGTACATGTGGTTCGGAGTCAAGCTGCAGCTGATCATCATGGAGGTGGTCCCCTTCCTGTCGC
TGGCTATCGGTGTCGACAACATTTTCTTGCTCATCCACGCTATGACCGAGAAGGAAGACCAACTCCGACGAGATCAGCCGAGTCTCTTCATTGGTCTGGA
GCACAACCCGAAGGCCATCGAGGAGATCACTACTGTCATCGTGTCCGAAAGTCTGGCGTACATTGGCCCCAGTATCTTCATGGCCTCCGCGGCTGAGTCA
GTAGCGTTCGCGTTTGGTGCCATCTCGAAGATGCCCGTAGTGCTGTGGTTCGCTGCCATGGCATGTTGTGCTGTGGCGATCAACTTCTGCTTCCAGATGA
CGTTCTTCCTGTCTGTTCTAACGCTGGACAA