Description :
From Genome Similarity Track
Location :
Scaffold_15:18251- 21056
Sequence
2805 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCACACGCTGGATCAATGAGGACCCAGTGGATCCTGGCCACCGCAGCAGGGGCCGAACTCGGTAG
ATCAATGTCGTCCGGATCGTATTCCCACTGAGAGAGATCTTGATCCGGCGATCCGGCTGATTCCATCTCCACGTCCCGCGATCCAACGTTGTCGTCGACC
ACTGGAGTAGGTGTTACCACCGTGGCCCGTTGTTCCTTCAGAAATCGAGCCATCGCAGCCTGAAAGTAAGACTCCAGTTTGCCATTCGACTCATCTAATC
CGGTAGCACTGGTGGTCCGATCGGTCGACTTGGGTTTCTGCTCCCGAGGTCCTGACCGCATGCGTTCCTGACGTTGACTCCGTGATCGTGGGTCCAACAT
CGCAGATCCTGAAGGGCCGAGGGACATCCGTTGAGGTTCAGACGACGTATCCGATACGTGTTCCGCTGCGGAGACATAAGGAGACGACGATCGGTACCCA
GTGGACTCCATCCGCGGCGACGACGCGGGAGCTGGCGACACTAGATCTGGCACCTTCGGGTCCGGACTGTCCGCGATCACGTCGACCAAAGGTCTCAACT
TGTCGACCAATGTCTGGATCGCTGTCTGGATCACATCGAGATCCTGATCGAAAAGATCATTCGCTTCAAATGGCTTCCTTCAACAGTCCGAGCAGGTTCT
TCACCGCCATCAGCTTGTTGTCCGTCACTCGGGGGGCCGAGATCGGGCCCTTCGGGTCGTCGATCTGCTCTGGCCGCAAGATCACCATGACGGGATCTTG
ACGCAAGAAGTCTCGCAGTTCCTTCAAGTGATACTGACGATCCAGGTCAGCCTCGGACCAGTCGAGCGCCGACGGTCTGGGATCTTCGTCGTCCAGGCCT
GGCGCTCTCAGCTTCTTCCTCACAATCCGGTCCTTGTCCGCGATCGCGTCCAGGTAGTCCGGATCGAGCCTGATCGGCGAGTCGGCGAACGCGTATCGGT
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTGCTTGCCGCTTCCTATAGCGGGATCGAGGTTGA
TCCAGAGGAGAAACGATCGCCGGCCAAGCACTAATACCCGGTCGATCGAGGACTTGCACCCAAGAGATAGATCACTAGAGTAGGTCAAGCTGGCCAATGC
ATTAATCCAGTCTTAACCGTACCGCTAGTTCACTACCCAAAGTGTCGACCCTGCCGAGGCCAATGTAGTTCCTGGGACTTGGTGACTTGAGGGGACTTGT
GCTCTTCGGTGCAAATTCTGCTCGAGAGCGACTTGCCGGGGCTTGGTGGTCTTGGATCACGCGTGGGGTCAAATCTGTTTCCACAACGCAAGTCGATCGA
GGCCAATATGCTCTTCCTCCTCGAGATTCCAGACCACTTGCGCTCCACGGTGCAAATTCGACTCCGATTTATGTTTAGCTGGTCTCTCCCTAATGCTACC
ATCTTGCTTACCCTCCTACAACCACACGATTACTGGATTCTTGCCCCGACTTCGTCCTCCATGTGCGTCCCATCATGGTCGATCCACGATCGGCCCCGAT
CGGCGACCCCAATCGGCGACCCACGATCGGCGACCCACGATCGGCTCCCGATCCACGATCGACCCCGATCGGCGATCCACTCCCGATCGATGACTTATGC
CGGTTGCCATGCGCCGCCGATCTATCACCTTCTGTCCTCGGCCATCTCAGATCCGCGGGTTCTGTCGTCGATCTGGACTTGGGTCGGCCACGAATCACGC
CGCGGTTCGGGCACGATCACCCACAATCCGGCTTGCCACATGTCCTGCCTTACGCGCCGGCGTCGTCGGACCACCTGAGATCTCCCGAAGAACTCCTTCT
GATCCGTAGATCCTTGCTGCCTGTCTCTCGATCGCCGATCTCCCACGCCTCCAGTCGATCGGCCCTGCCGCCTTTCTCGGAGAACAATTCAGCACTTCTC
CACAGTGTCGTCCCAGACGGCGCCGCGGTAGTAGCAGCAACATCGCGTTGCTCCATCAGGATGAAACCCTGTGTTGCTGCAGCATCGTAGCTACAGCCGC
CTCACCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGGTCCGACAGGTGGAGACAGTCAGCGCGTGCAACGTGAGTTGCACGCGTAGTGAAG
CTTTCCATGGGCACCTCTGTATACATGGGAAGGTTCTCAGCTCCGCGTTCGTGCGGTAACGTAGGAATGTTCAGGTAGTCGGTCGTTGGACGGGCTTCAA
AGTGCTACCAGGTGTAATGGGCCTACTTTGGCTCACTACTTCAGCTTACACGTGTACGCACATCTGTGAGGAAGCGTAGCTTGGTTTAAACTAGAGTTAA
TTATACTCGGACCTCCGAGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGTTTCTGAC
TTCCT