Description :
From Genome Similarity Track
Location :
scaffold_1045:1825- 2916
Sequence
1091 bases(100 bases per row)
ACTGTATGGCGTACCGATCCGCCAAGCTTGGCGGGTCGGTTTGTTCTTCGCTCGTAGCGAGACATGCCCTTCCCCGGGCTGAGTTGTTCTCTTGACGTTA
CCAGTGAGCACCCTACAAGGTATACCAATCGGGTTCTGACAGCAGACACAATCCGGCCCACGCAGGGACTCACCGAAAGCGTATACACTTGTGTTGGACT
TAGAAAATTCTGCTCTGTTATGTTCCAGGGACTTAATGCTCTTTGCTATATTCTAATTGGTTCCTATACAAGTATAAAGTGTAATGGGGTCGTTACAGAT
CTCGCCGAATCTTCAGCCGACTTCTTGGACGCCTCCGAGGCTTGGCTGACTACCGTTGGACTTGTCCACGTGTCGCACCTTAGCCCTTGATCCTTCACGT
CGCTTCGGCTGAGTGCGCGTGGCCGGTTTCCTTGCGTACGGTCTAGGCGGCTTTGGTCATACCGTGATGCCTTATTCCTTAGAACCCACTTAAGCTGAGT
CCGTACCGCGAGCCACGACTTCTTAGACATCAGTATCGAGTCGGCAGGTGTGCACCGTGGAACACCAGTCCGTAGCCTCAACCGGGACAAAATCTGACAT
TCCCTACTCCACAGGTAATAACTGGGACTAAAGCGTGTTTCGACAGTTAATTCCTCCGCCATGATTCGCTATGGATGCTTTACAATTCGTGATCGCAAGA
CTGATCATGATCCTCAAGGTAGTCGAGAATACAATCTTCACTTTCTTCCAAAGGATGAACAAGCTACTGACGCCCTCACGTTTGTACAACGTTTCATCAA
TTTTGCGTCAATAAGGAATACAGAGCGAGTGGGCGAGGGTGGTCGATGTTCACAGCGATCAGGGACCACGACCATGCAGATTGGACACTTTAGATATTCG
TATAGACACCGCCCCAAACAAGTCCAGTCGAAGAGGCTATCACAGTGGGTATTTTTCGCTGGACAAGTCACTGGTCCTCTGAAGAGATGATCTCGTAACA
CAGCATGCACACTTGGCCTTCATCATTCGGCCCTTCGTCCGAGGCTTCACTAACGCGAATTGTCACATTGGACGTCGTATGATGAATTTCA