Description :
From Genome Similarity Track
Location :
Scaffold_453:18243- 20254
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_453-snap-gene-0.9Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_453-snap-gene-0.12Conserved gene of unknown function

Sequence
2011 bases(100 bases per row)
TCGTTGCGATTGATTTCGTGCGTAAAGAAGCCGAACTTCTCTGTGCAAATTGGAGCGTCAAAGATTCCAAACTAGGTTTCACAGGGCGCGTCATCAACGC
AGAGACAGTGCAAGAGCTCGAGCCATTGCATACCTTGGAGGAGAATCGCTGGATCTCCACACTCAGTGAACACGGCATTTGCAAGGACTGCCGACGAGTG
TTCCATGTTTCCGAGGGAGATTTGCAATCCAAGCATGCAAATCGAGAGATCTTGGACGCGCTTCTTGCTGAGGTGAATGTTCTGAGGATGCAGAAGCAGC
ACTACATAAAAGAGAAGAAGCACGAATCAGTGCTGCAGACAACAACGCAGCTGCATGAGAAACAGAAGCAGATCCAAGCCACAAAGAGGCAGCTGGAGTT
CCTGGCGCCGCTGTTCTGTCCATACTGCGAATGGACCAGCAGCACCACAGCAACCTCACCATGACGAAGCTTGCGCTTGCAACAAACCTAGACTTTATGA
TGTATATTTTGCGTCTAATAAAGCGGAGTGAGTCATTCCTCTTCACGCTCTTTTTCTCTCTTTCCCTCACGTTCTTAAATAGTCAAGCGAGACCAAGTTG
GCTAGTAATCGAGTAGCAACATGTACCATAGAATGCACGACTTGCTGACTCGACATCAAACGACAGGACTCACGCTTCGAAGCTACTGGATCGAGCACCC
GAACCATGAGTCCGACGCATCGGCGCTCATCATGCCCGTCATCTCCGTATCTAGGTGCTTCATTGCCTGCGCGACGTGACTGACAAAGTACGGGAGCCAC
ATGCGGTCGTACAGAAACCGTGCCGTGAACGGGAGGTCATCTTTATATGCTTGAGCTTCTTTGTCCCCGCCCCAAATTCGACATCGCTCCACGATCCACG
GGATCACGACACGCTTCGGTTTGCTGGCACGGAAGATTCGCGGGACGACATAGCGCTGGAAATTTTGCTCGTTAAATGTTCGTGCCAGCATGGGGCTAAA
CACTCGCTCTTCTGCTGTCAGGATGCTGTTGGTGAGCAAATTCAACTTCCGAATATCACTCTGCAACACGAACAGGCGATCTTGCCACGAGCTCGACGCC
GATGCCGCTGAAAGCACGATCGTGTCCTCCTGTGCGATGATCGCATCCAGCAAGTCGTAAATTTTACCGTAGTGCTCGAGGATCTCTCGTTTCACCACGT
AATCCACTTGAAGCAACGGGAGCACCACTTTCGTCTTCACAGTGTGCTGGTTCTTGAGAAACTCCACGAAATGCGTCTTGAACCACACAAAGAACTCATT
CACATTCCACTCCATCGGGGACGAGCGCTGGTGGACTCGGTCCAAGAAACGGTCGATCACGAACAGTGCATGACGGACAGGTTCATGGATCCCAAGCAAG
AAGCGCGCATTCCAACTCTGGTCAACTTGGTTGTTTGTAGCAAGCACAGGTGAAAACACGATGCTATCTCCTCTCCGCAATGGCCCAGAAACAGGAACCG
ACTTCACCATTTCCAGTTCTTCGGCCGATACGCCCTTCTGCAATCTGCCGCGGAAGGACGTGCCGCCGTCCGAGCTCGGGACCTCACTGTGAGCCTCGGT
GACATGTAACGGCCGCGTATCGTCTTCGTCGCCCTCGGTGATGTCGGTCAAGTTGGTCATGTTGCTGAACTGGCGCTCCGAACGACTCAATTCCACGCCC
ATGCTATTCAACGACGATGCAAGCGAGACGACGCCGTCGGTCTGCCAGATATTCATCAGCTCATTATCCTCAGCGCCACCTTCATAGCCGCGCTTGTAGT
CAATCGTAGTCACCACGTACGCGACCTGGCTGATATCGATAAACTTGTGCACGTCTTCCTGTTTCCTTCCTGCCGTCGTCGTCGTAGGCGCAATCCAAAT
GTTAGTGTAAAACTCCGTGTCATCCGGTTGCAAATGCGCTGGCGGTGGGTATTTCTTTGGGTTTTTGCTCTTCCCAACGACCGACAAGCGGCTCTTTTCC
AACGGCTTGCG