Description :
From Genome Similarity Track
Location :
Scaffold_313:18241- 19554
Sequence
1313 bases(100 bases per row)
TTGCTGTTCGAAGCGTGCTCGGCGTCTTGAATGAACGAGAACGCGCCTAATTTTCTCTGTAATTTTCTCTGACCTCGCACGAATTGCCACCCACGTCAAG
ATAGGCATTTTGTGCTGCTCATAGCGCTCGAACCATCATACGAGAGTCTTTTCAAGAAGTGGACAGTGTACAGGTGAATGGGTTTTCGGGTTGGATTAGA
GCCGGCGTCGTTCTCTGTAACTGGATGCTTTATTGAAAGCAGAACAGCCGCTGGCGAGGGGGGTTTCTTCAGTTTGGATGTTGAACCTGCCCATGTGGCG
AGCGCACGCAGTGAGGTATCTGGTGCTAAATGTGATAGCTATATAGCGCTAGCTTCTGCTCAGCTGAGAGTAGAACGAGTGACGTCTTTGCTGGGATTCG
TGTATTTGGTTTGGTGGGAGGCACTCACCTGCTAACAATACTAACTGATAATCCCTCTGTTTCACCATGGTTGTCCAAAATTAAGCGATTTGTTGTTTCA
TAATGTTTCTCCATTTGGGGAAGATAAGTTCATAGAGGCAAGCATCGAAAATGTGTTATATCACGAATTGTGATTACTGTCCAAATGATACATTTGATTG
TATTCAGTTATAACGGTAAAGCATTTATAGAGGCATATTTGCATCCTTTGAGCTTAATGAAGCGTCCATTTTGCGGAGCAAGAATGATTTGCTCAAAGTG
ATTCAGTGTCCCGGGCGCAGATACTTTAGCTCTTCGTGTTTGAAGATTTCATCTTAGTCCGTACACGTAAAAATTGGCGGCTGGCCACGCTTTGCAATGA
CCGTCGGCTTATGCCCCTTCGAAACTGATGGTTTTGATCAGTTGATTACTAGCTTTATGCTCGGTGAATCCGTGACCAGAATTGGCGGAATGTGCGCAGA
TTGAGCTTTATTTTGCGGTGTAGTAGCTAATCAGGCTATGAAAATTGAATTTCTTTTGAGATGTTTACCCAAAAATGGACAATCACACTGAAACAGAGAG
AGTACTTGTTTCACTTAACGTTGAAAGAATTGACTATTTGAGGGTATTATATTCTTGTGGTGTTTATCAATCATAATGGTGACTGTAACTCTATATGTGT
GTGCCAGACCTTGACAAGCTTTTCAGTAATAGCTGTTTCTTATTGCTCTGATATGCAGGTCATATCTTTGCTCTTAAAGTATCACAGTGCGTCTATATAA
ATCAACTGCTTTCAAAAGTACATTCTACAATACTCTATTATTTCGAAATCATCGGACTGCTTTCAGACATTTTTAAAATATTTTGAGTCACCTTTAGGAA
TCATCGGCCGTGT