Description :
From Genome Similarity Track
Location :
Scaffold_368:18240- 19588
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_368-snap-gene-0.12Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_368-fgenesh-gene-0.7ATP synthase mitochondrial F1 complex assembly factor 2

Sequence
1348 bases(100 bases per row)
CTCCATGAGCAGCAGTACCTGTCACCCTCATCCGTCAGCATCTCTAATATCCCAGTGGCCGCGTCAAATCGGATGTTTTTCCACTGGGAGGACACCATGT
GCGCCGACAAAGTCGCGGCTGCACTAGGGACTACTACAGAAGCAAAATCTGTCGGTGAGGCTGCTGAAGTCGACGCGATTGCCCTGGAGCTTTGCACAGG
CTCCAACTGCCGCACGTGTAAGCCATCCCATGACTTGGATGATGAAGTTGAAGTCGACCAGGGTGTCAGCGGATCATCCCTGGGGAAAAACGTGCTAATC
GTTCTCTTGTCATGCTTTGGGTTCCTGCTGACGTCCACGGCGCTGTTCTACCTGCTCACTCGAAACCATTTTTTTGCCACGCTTCCGCCGCCGGAGACCA
CGAAAAACGACGACAAAGAGCTGACATCGAACATCGCGTACGTCTTGCGCATCTAGGCCGAAAGGGAGTTGATGCAGAGTGCGGCGTCTGTTCTGTTGTG
TATGTGCTTGTGCCCAGCGTGTATATCTATGGGTCTGTGAGGCGTGCAAGAACGTTAGTTTCTTGTTGAACATTTTTCTATTATAGCGACATCCTGAGCT
CTTGTGATGCTTGCAGTTTCTGTCTTGTTGTCTCTGTTCTTGCTTAGTGGCCATTCTGGAACAGCCAGAGCATGAACGACGCGCTCGAGAGGTTGACCGC
GCAATTGACGCGATCGAGATCGTGGCCACCTTCGACGAGTCCCCAGCGTCCGATCTGGAACTCCTCTTCCAGACGTGAGAGGTCCATCGCATCCTTGGCC
GTGATGTGGCGTTTGAGAAGCGCCACAGCGGTGATGAGAGACTGTAGCATAGCAATAACAGACACCATGTCAACGCCATGAGAGTTACAAAGGGAAAATT
ATGGAGATACGCAGCTTCGTACCTTGCACTCCTTGGTCGCGAGACGCAACGAGACCATTTCGTAGTCATTCAGCTATAGTCACGACGACAAAAAGTCACG
TCAATCATGATGCAAGCCCCCAGAGTTCTCTACGACGAGCGCTCAAACCACACCTGCTCCAAATGCGCGCGCACGTTCTTCACGACCTCCTCGCTGTGCG
TGAGGCCGTTGATCGTGCCGTGGCTCACGTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCACTT
CTTCTGCTGCAGCGCCGCGAGCTTGTCCTGTTGATCGGCCGTGACCTGGTAGCAGACCGTGTCCGTGTGGAAGTAGTGCATCATCTCGTTCACAAGCTCC
TTCTTGCTCGAGGTCTTGCCGAGATCGAGCGCCGTGGACGCGAGCGAC