Description :
From Genome Similarity Track
Location :
Scaffold_81:182386- 185060
Sequence
2674 bases(100 bases per row)
GTACCGCTTAAGACGTCCGACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGAAGGTCGATGGTGTACGACGCACCATGTCTGACCAGGACTGCAAAA
GGTCCGATGAAGCGGTGCTTCAGTTTGTTGCTGCCGACAGAGCTAACAGTGTCTAGAGGTAGGTTCCTCGTGTCTAGCAACACTAAGTCACCAGCCTCAA
ATATACTAAAGTTTCCTCTTCCTTGTTTGTCCGAGTACTCCTTTTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAATGTTCAGCTT
GGTATCCATAAAGGATTCCACCTGTTTCCGCAGCGAAACTGGCCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATA
GAGGAGTCAGTGTTTCCTCGAAGAGTGAGAGGCACTCTGGGGTGGCGGAAGCCGTTCAAGTAGAGCGGTGTGAACCCCGTGGACGCGTGCACCGCGTTGT
TGAGCACAAACTCAACAACTGGGAGCTGCGTCGACCACGTACGTGGTGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTC
TGTTTGGCCGTCGGTCTGCGGATGGTCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGATAACAGCGTTTTCCAAAACGCGGCAGTGAACCGCGGG
TCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTTATAGTGACGGGAACTG
GAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGTCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCAT
CGACTTCCAACAATCAGCCGGTACGGGTAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCACATGTCTTGACGTAC
CGGGCGACCCACTTGTACATGTGGGTCCACCAGAAGGACTGAGAGACCGACAGGAAGGTCTTCTCGCGGCCTAAGTGGCCGCTGGAGGGCGCGTCATGCG
TCTCCGCGAGGATGTCGAACTTCAGATCCTCGTCGTTGGGTACGACCACCCGTGGAGGATCAGTGGGCTCCACCCGATAATAGAGGAGGCCCTCCTTCAA
CTCATATCGGTGGAGTCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTCGTTCCAGCCTTAAGGAACTTGACGATAGGCGCGACAGCCTCA
TCGTCCCGATACGCCATGCGTATCCGATCGTATAGATCCGTTGTCACCCGCGTGATGTGGGCCAACTCATAGTCGGGACGCCGAGAGAGGGCGTCCGCAA
GCACGTTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTGTATTCCGCGAAGAAGGGCAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAGT
CGCCGTCCTCAAGGACGCGTGGTCTGTGTAGATCACAAAGGGCCTAGAGCCCAGAAGGTGAACACGGAACTTCACAAGGGCATATTGCATTGCCAGGAGC
TCCTTGTCATGGACAGGGTAGTTCCGCTCGGCGGCTTTGAGCTGCCGGGACTGGAACGAGATGACTCGTTCCTGTCCAGCCGTGATGTCCTGCAGCAATG
CACACCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAGAGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGAT
GCTGTCAAAAGCATCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCTTCTGAAGGAGGCTCGACAAGGGCTTAGCGAAGCCCGCGTACCCAGCGCTG
TACTTGTGAAGGTAGTTTCGAAGATCCTTCTGGGATCGGGGCGTCGGCCATGCTGCTTTGGCCTTGACCTCTGGGTCAGCCCGAACGCCCACGTTGCTTA
CAAAGCAACCGAGAACTTTGATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATCACGTCCAACACTCGACGGAG
GTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACAAAAATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAAGGGCGG
AACAATTGCGTCGCCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCTTAAAGCATGCCGCTTGGAGTGCTTACCG
CGGTGAGCGGGATGTCACTCGCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGTGCACTGTACAGTACGCTCCCGGCCATGTTGTTCAGCAA
CACATCCTTTCGTGGGATCGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGGGAACCAGACGCCACTTTCCGTTCGGCTTACGAACG
CAGAAAGTCGGCGTCGAGTGCGGGGATTTCGACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGCG
GGAGAGGCCATTACAATACTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGGAGTT