Description :
From Genome Similarity Track
Location :
Scaffold_72:182327- 184157
Transcript NameFunction/comments
Hyaar_Emoy2808003hypothetical protein
Hyaar_Emoy2808004hypothetical protein

Sequence
1830 bases(100 bases per row)
TCTCCCCCCTCTCTCTATAAAGGGTATGTAACACGCAGCGACTTCTAGCTTCAAATGTATCGCTTTCTCTCGAGCACCAAAATATAGATCTACCTTCTAC
TGTCCATTACTGGCTCTTTACGTGACTTTCTTGAAAGATGGATGCTGCACGACAAGTCAGCGAGAAGAAAAAAGAACGAAAACTCGAATAAAGAACACAC
CTCCCAGCCACTGTAGCCGCCCACTGACTGGCTTGGTTCCTGTGTTGACAACCAGGATCCAGCTGCATCTTTCTCCATTTCTGCAACCAAAGGACGACAT
GTCGCACCCAACAGTACCTCGCTCTCTCTCTCTCGCTTCGATGTACAGTACATGGTGTGTCGACGTCGTCAAAATTTGTTCCCACGTTCGATCCGCCACA
AAAAGCCAGGCGCTTTTTTCTCCAGCAGACGAGACACGCCTCCTGCTGCTTTCTCCCGCCTTCTCGCATCGTTCGCTCTATTCCATCCAACGACCATTTC
GCTATTATCCGCCACCACCAGACGCAAGAAAAAGCAACAACAATAACAACAACAAAAAAGCACAACTGCCATCCCCAATCACGTACTTTCAGACTGACCA
CTTGTTAGCATAATTAGGTTTTCTTCAAAAAAGTCATGCTCGCGTCGCTCTCGGACCTGCTCGTCTGGAAGACCAAGCAATCCACCAGCACCAGCTCCTC
CTCCTCCTATACAAAATTCAAGCGCATTCACAAGTACGATAAGCACAAGCGCGCGCCCACTGCCACGTTCTCAGACCTCGACGAGTCCGAGACCGAGAGT
GTCATAGCGCCCAGGACGCCGGAAGATGTGCCAGTACGGAAGCTGGAGCCGCCGCAAGGACGTGAAGGGAAGCAGGAGACTGAAGACAAGGAGCTCCTGT
GTGTGGGGACGCACGTGTCGACGGCTTTTGGTCTCGGGACGGTCGTCGCTGTGCGCAAGGAAGACGGTGTGGTTGCTATCGAGTTACAGCAAGGGTCTGG
ACTGTTTTATCTGGCGAGTTGGAAGCAGAATCAGAAGCAGAAGCAGGTAGAGGTAGTTCCTGTACTTGTTGGGGACCACATTGAGACGGTATTGGGACGA
GGATGTGTGGTGCAGTACAAGGCTCTGGATGAGGTGTACGTGCTGAAACGAGGGGAAGCTAGTGGTGGTGAGGAGGAGGAAGGTTGTTTTTTTCAAGTTT
CGGTACGGGATGTGGTGATGCGGGATGGACGGACGTTTGGACGACGGTGGGAGCTATTGCCGCGGTCGCGGAGCTTGTCGGAAAGCAGCACGAGCAGTGA
AGACGGGGACTTGAGACGCCGCACTCGTCCAAGGCTTTCTAGTACGAGCTCTTCGAACGGGTTGACGCTGCTGAAAAGCATTGCATCGACATCGTATACG
TTTATTGCGAGCAAATACTTGCAGGGACAGCCCGTGATTACCAAGTTTGGTGCAGGACATATTGTTGCCGTGGATCCACAGCGAGGGTCGGCACAGATTC
AGCTCGTGTGGGGCGCCACGGCATTCCTGAACGCTGACATGATTGACTTTTACCCCAAGGCTCTAGAGGGCACTGACGTGCACACGAAGTTTGGCTCGGG
TATTGTAATTGGCCTTCGACCAGCGGATGCGATTTATACCGTCCGGTTGCATGACGTGCAGCCTGTGGGGAAGTCGGATGTGGTCTTTGTGCATGAGTCG
GACTTGCACCGGAGTCGGAAGATTGCAGTCACGGCTGCAAACGTCCGAGACAGATTGAAAGCAATGGCACATCGTTGTTTCGGTGAACGCATCGTTGTCG
CGCACCAGAGCCACGATGAAGAGCCAAATT