Description :
From Genome Similarity Track
Location :
Scaffold_2794:1823- 2888
Transcript NameFunction/comments
Phyta_totarag14842hypothetical protein

Sequence
1065 bases(100 bases per row)
CGGCGTCACATACTCCGGTCTTTCCACTGCAGTCTCCCACAGGTACTTCAGCTCCGTCGAGCCTTCCAGCTCGGACTCCCCGACGGTGGCTTGCAAGGCG
AGGTTCTACCACTCCATGTAGCGGTGGGACCCAACCGAGACGAACCCGGGGCTCCGGGAAACGCGGTTTCCGGCAAGCCACATGCCGATCGTCTCGTCGC
CTCGGAGGATAAGTGCCTTCTCGTCAATGTACGTGACTTGCAGGTACTGTGACCTGCCAGGACCTTTGATCATCGTCGGCACCCACCGTTCACCCCGCGT
AACCCACAGCTTCTCAGTGTCTGATGTCCACAGGCGGTGCGGCAGCTCGGCAGATTTCCCGTCCTCGATCTGCGTATGCTGATCAACCTTCAAAACCCGT
ACCTTGTCAttgaagagctggcgacgTCCGCTGAGCTGGATCCTGACCTCATCGGGCAAGCACAAGGATCCGTCGCCAAGATCCAACCGGATCCCAACAG
GAACCATGAAGTCCAGGCCAAGGATCGCGTGCTGACCAGCTAAGGATCCGACCCAAGTGTCGAAGTAATACACCAAGGATCCTGCCAAGGTGATCTTGAC
TCTTGTCTTACCATCCGTCATGTATATGTTTTCACCAATGTCGACACACTCTGATGTCAATACAGCATCCTACCTTACGAGTAAAGGCGGTACCCACAAT
AGCCACCTCGGATCCGGAGTCTAAGAATAAGACAGCCTTCTCATTGTTGACCTTGCATGTAGCCTTGGCTTGTTTGAACCACTTCTCCGGTGCGTAGTAT
ATCCAGATGCCCCGAGACTCTCCGGGTAGGGGGTCAAGGGCCACCATGACATCAGATCGCTGGAGTACGTTGTTGATGAAGTTCACATGTATTACCGAAT
AGATCCGCTTGCTTGTTGCTAACAGGATCCCTCGATCGTAGAACGCTCGGCTCGTACCGGATTCAAACCCAGCGAGCGTTCTAGTTTAACATCTTCTCAG
CAGACTCAGGTAACATACCCGCATGCTTGTTCGGATTGTACCACTGACGGATCATGTTGTAGAAC