Description :
From Genome Similarity Track
Location :
Scaffold_170:18229- 20140
Transcript NameFunction/comments
Phyke_g9428myosin-like protein

Sequence
1911 bases(100 bases per row)
CGGACGGTGCCAATGATATGTGCACCCTCAACCACCTTCACGAGCCTGCAGTTCTTAAGAACTTGGAGCTTCGATTCGCCAAGAAAATGCCTTACACCTA
TACCGGCGCAATCTGTATCGCCGTGAATCCGTACCAGTGGCTAGACCTCTACGGTCGCGAACTGTACCAGCAATACTTGGACCAACCGCGGGATTCTCTA
CCGCCGCACCCTTTCGCCCTATCTGCCATGTCCTATGTGGACATGAAGAGGACCCAGGTGGACCAAAGTATTTTGGTCAGTGGGGAGTCCGGTGCTGGTA
AAACGGAGACTGTCAAAATTATGATGAACCATCTGGCGTCCATTTCGGGGGGCGGTCAACAAGGTACGAAGGTCATTGACCAGGTGCTTAAAAGTAATCC
GTTGCTAGAGTCTTTCGGTAatgccaagaccaagcgTAACGATAACTCCAGTCGCTTCGGTAAGTTCGCGCAACTGCAATTCGACAATGTCGGACAGTTG
GTCGGTGCCCTGTGTGAAACTTATTTACTTGAAAAAAGTCGAGTCGTTGGTCAAGCCGAGGGAGAACGCAATTACCACATTTTCTATCAGATTTTCCGTC
TCGCGGAGAGTCGAATGTCCGAGTTGCGTCTGCATGGCGATGCGTCCAACTACAAGTACGTGCAGGTCGGGGCGGACGCGGCGTCCTCTGGTATTGACGA
CTTGCAGACGTTGAAGGAGACTCAAGATGCTCTGGATGTGATCGGCATCACGACCGAGGAGCAAAATGCCATTTTTGAGATTGTCGCGGCTATCCTGAAC
CTTGGTGAGGTCGAGTTTGAACAGAACGGAGCGGATTCGGAGAAGTGCCATGTGAGCAATGAGGAATTTGTCGACAACATTGGacacttgctgcaaactg
AGAGCGCGGCGCTGCactcgacgctgctggagcggTCCATCACTGCCGGTTCCGAGTCGTACACGATCCCTTTGAATGACGAACAGGCATCAGACCTTCG
TGATGCTCTGGCCAAGGGCATGTACACGCAGTTGTTCGACTGGTTGGTGCACCGTATCAACAAGGCTATTTGCTCCACTAGCAACATGCAGACGCACATT
GGTCTGCTGGATATCTTCGGTTTCGAGAGCTTTGAGACCAACGGCTTTGAGCAGCTGTGCATCAACTACGCTAAtgagaaactgcagcaaaagttCAACA
GTGACGTGTTCAAGGACGTGCAAAATGAGTACGTGGAGGAAGGCATTCCCCTCACGCTTGTAACGTTCGAGGATAACCAGCCAATTCTGGACTTGATCGA
GGGCCGCATGGGTATCGTCAGCATGTTGAACGAGGAAGTACTGCGTCCCCAGGCGACGGACAGCACGTTCGTGAGTAAGGTTCTAGATGCCTGCAGTGGC
CACCCGAGCATCGAAAAGAACAGAGTGAACCCGATGCAGTTCCTGATCCACCACTATGCCGGTGATGTCATGTACACTGGTGAAGGATTTTtggagaaga
acaaggacaCATTGCCCACTGACATGGTTCAATTGCTATCTGGCAGTCGGAACGGCGTTATCTCGGGTATTTTCGCGCCTACGCAGGCCTCGAAGCGCAA
CAGCCGTGGCAAGAACGGAAAGGAGGGCCGTCAAAAGGGTTTCCTGGTCGGCAACAcgattgctggtgctttCCGCAAGCAGCTGTCGGAACTGATGTTG
ACAATTAACAAGACGTCTTCGCAGTACGTTCGCTGCATCAAGCCTAACGCAAACAAGAGTGCTGTGGAATTCAACCGCTGCATGATTGTGGAACAGCTTC
GTTGTGCCGGTGTGATTGCCGCCATCCGTATTAGTCGCGCGGCCTTCCCGAACCGTCTGCCCCTTGTGgagttccagcagcgttTCCAGATTATCTGTCC
GTCAGCGCTAC