Description :
From Genome Similarity Track
Location :
Scaffold_176:18228- 19230
Transcript NameFunction/comments
g10668.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
TACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACCCATTGCCATGCTTCGCCAACACGGTGAATG
GCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAA
TTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGG
CGCTGGACAAAGTCCATTGCATCCGAGCTGAACCTCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTACGCGTGTTGTTCGTTGTCGTTTG
AAGTGTCTACGCCCGTCGTAGACACTGTGTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTG
CTTATCCGTTGTTTTGAATTAACCGGATACCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCA
CGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGACGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTA
GCTCTTCATGGTGTCAACCAACACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGT
GTAAACACTTCTTGCCAGAATCGCGCTGTAAGGCGTGGATCCCGATCCGACACGATGTCGCGTGGCATACCATGGTGTCTAAACACCATGTCAACAAACA
GACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTT
GT