Description :
From Genome Similarity Track
Location :
Scaffold_9:18225- 22169
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004337Protein of unknown function
Pytul_DAOMBR144PYU1_G004336Protein of unknown function
Pytul_DAOMBR144PYU1_G004335Protein of unknown function

Sequence
3944 bases(100 bases per row)
GGAGCCGTCATCGTTGGGAAAACATACTCGCTGTGGGTTGACCATAGACTTTGTTGCTTGTCCCAAAGCTGTTCCCATCGTTGCCTTTGCTTTTTCCTCT
CAGCCACTGTGCTTAGACTGTCTTCAAGCCTTGGAATGTTCGTTTTTCCTTTCTTAATGGGTACTGCTGGGTTATTTCTGTTCAGAAGGTCAGGGCCCTG
TGCAGTTTTATCCATCGGAGTGGTCACATGTCCGCGCTTTGTTCTTCCCCCAGCCAAGTGTTTGATGGGCGTGATCGGCGGCGTTGCTTGTGTAAACTCC
GGATCGTCAGACTCGCTATTGGCCTTTGCCTCTTGCGACGAGATCAGTTCATGCCACTGCCTCATTTTTTTCTGCCACAATTCTAATTCTAGTGCTGAGA
TTTGACAGGTTTGAAGCCATTGGGATATCTCTTTCTCATCATCAAGGTCCAGTTCAAGCAGCGCTTGCTGTTGTCATTGGTTCACGAAATTCGGGTCCTG
CACAATGAACCTCACTAGCTCCTTCTTCCTTGGTCCTCCTGAATTGATAATCTCTCGGACTTGGAGCCGGAAGTGGTGAGGCACTATTGGGGTTCGCAGG
AATTGGTTTCGGTCGTCTATGTTGCCAGAGAAGTTATCTGCATTCTATGGCAAAGCGTGCGTGTCCGCCTCCCCATCGCCATGTATGTCTTCGGCATTCT
CGCTGCTGGAATCGTCATTTTCAAATGTCGGCGTAAAGTCGTTCTTTTCGTGGTCATCCATATTCACATCGTCTTGCCCGTTGTTCGCATTCATGTCCGT
CCTCGAGCCATTGCTGCTCGTTCCGTTGATCACACTCTCCTTTGAAGTCTCCAGAAATTGCGACAAGGACGATTGGTATGTCATACTGTTGCTGCCAGTC
AGCTTCGATTTCTTACTGAAGAAGAGACTAGTGTAGTGACCACTGCGGTAGTGGACGACAATGGGTAAACGTGCACCTTCACTCACTGCTTCGTGCTTCG
CGTTGAGTAGTTCCGCACGCCAGCCGGCACTCGAGACTGAACATAGGTGTCCTGTCTTGAAGGTATGCCCATGACGGAGTTCCTCCCTCGGGTGTATGAC
CGAGAAGAAAAGACGTTTCTCATATTTTATCGCGTTTGACACTAGGAGGATGGGCGTATTCAGAAGGTAGGCTGCCATTCTTAACGTGTCCCAACCTCCC
CAATGCGTGCTTGGGATTATTTGAGTCAAGTTGGACGTGCTGCTGGCTATATCATCGAAGTACTGGCGAAATTCTTTGCCCATCTCCACGTCCGTGAGCT
TGTCCTTCGTGCGGTGCAGGATGCTCAATGAGTTGTACCACGTATCTTTTGGAAAGTGAAGCTCAAAATTGCAGAAGGCAGCAGCTCGTAACCCTTTCTT
GAGTTTACCTACGTGGATTTCAACGAGTTTCTTGGTGCTTTCCGTGCTTGGTTCGACTTGAAGCATGCTTTGGGTAGTTACCACACACTGGCAGTTTCCA
TTGCTCGCTACTTTCACTTCCCGCAGGCCACACGCATCCAATAACGTGTCGAATGCGATCAGGCGATCATCCGTCTCCATGCTGGCATTCTCCTCAATCA
GGCAATCTTTCTCGACCTCATATTGGTCATACTGGTTCAATAGCTCCCGTTGAATGCGATCCATCTGCTTGACCCATTTGATAATGTTTCTATCCTCAAT
CAGAGGCTGGAAGCTAGTAGATTGTTGGCGTGACTGCCGTTTGTGATCCACTGTTTCCGTTTTCAACTCTTCTTCTCCTCCATTGTGACCGTGGGTCAGG
TCAACAACCTCTTTTCCTGCCTCTCTTTGAGCATGCGCTCCAGTCTTGAGGATGCCTTTTGGAGTCAACTGTTGACTGGCTTTGGGGTTCTTGGAACCTT
TACGTCTGCCTGCCTCCTTCCATCCGTCGGGACGCGTTGACTGCGTTGTACGCCCTTTACCCTGTACGTTGGGTTGAGTCCCTGTCGCCGTCGGAGAGGT
TGCCTGCTCTGCGCTCTGGTTAAGTTGTCCGTTCTGATCCGACTTTTGGTCCATGCCCACTGTCTCTGCCTTTGGAGCGCCTTGTACTTTAGCCTCTTGA
CTTTCCATTTGTTCAACTACAAAGTGCCTGAGCGCTTGAAAGCTATCGAACGTGGTTTCTCCATTAGATTGGAGTGCTTTAGCTGTGGTTTCGTCGATCT
TTATACATCCTTTGTCTCTCAGATCCGCTTCCGTCGCCTTGCACGCTCGTGCGATGTGACCATGTTCACCACAGATAAGGCACGGTAGACGCGATGCTTT
GCTCATATGATGAACGATTATCGTATGACCAAACCAATTGGGTCGGTAGACCCCTTCCAGAAAGGTTGGGCATCCAGGAAGGTGAAATACCAGGGACCAA
ATGAGTGATGCTGGGGACTTTGGGCCCCCTTGTCGCATTCGTCCAGTTCGAACGGAACCATGGTATTGGCTTCCAGAAATTTTGAAAAGCGACTAACGTC
CATGAACGGTGAGATGTTCAGGAGTTGGATGCGGTAGAGCTGAGGCGTGGTTTTGTCCTTGATGCCGTCCGTCGCCACTTGGCGCTTCCAAATATCTGAT
GGTTCTTTGATGGTATCAGGTTCGTGCACATTCACTACTGGCAGCTTGCGGTGCCTGAAAGGGATTTGCAGATCTACAAACCGCTCTGCATGCTCTCTTG
TCAAGTAGAAGAAGTGAATTGAGTGTTCGTCCGCATTGTACGCCACCTTTTTCACTGTCCCCAACATTTCCTGTAGTTCTTGAGAGTTTGCCCTTCTCTC
CGTAGCCGCTGTGTTGATTGCGTCCACAATGCGCTGAGTGGTCTGGTGATCTTTGTACAGCGGGAGGTCATCCGTAAGTACCATCTTGAGTTCGCCCTCT
ACCTGAGCCCGAATTGCGTTACGGAGTCTAAGTCGTGCCTTGGTGTTCATGAAATGCTTGGTAAATTGAGGTAGATAGTAGCTCACAATCGTGCCCTGCG
TCAATCCTTCCAAGATCTTCCACTCGAGGTCGGTCGGTGCGCGCAACTTTGCTGGGTACTCAAAGGCTGCTTCACAATGCATGCGCATCCTTTGGACAAC
GTCGGAGGAGTATACTCCACTGCGGAATCGGAATGCAGATTGAGTTGCTGCCACTGATGCCGAGGTGTTGTTTGGCTGCACATGTTGATCAAGGTTTCCC
CATGGACTGCGGTGAGGGACTGCTAGAAGCCGTTCCAGGGCTAGCTTGCCTTGGAGGATTTTTGTGAAGGTCCACTTCGAAATGTGCAGTGTTCTGCATA
ATTCTTTTACAATTTGGGATCACTTGAGCGCAGGATCCTGATGAGATTTGTGACACAGCTATAGCAAGTCTACCAGGAGGTCCGCTTCTTCGGTCGTCAA
TTGGGGATAGTGACGTTTCGTTTTGACGATTTTAGTCGGATCAAACCTCATCTTTGAGCACATTTGCTCAAAGATGCTTCGAATGAAAGCCAACCATTCG
ATCGGTCGCTCATCGTTCGTCTTTGTTTGAAATCCGCCAAGCAGTACTGCAAACATCTCGGCTGTAGTCATCAAATCTTGGTTGTCAGATGCATTCGATA
TCTGATCCGATGTGGCGTCCGGAAGATCATTGCACTCTTTTTCTGCTGGGTCGCTCGTGGCATTCTCCTGCGAGTTATTCGCGGTGGTGACCGATAATTG
ACCGTTGTTGTGCCGCGACTTCCTCACTGCTCCATCCACTGATTCGTTTCCGTGCTTTGCGCTTATCTCCTCGCAGTCATTGGCTGCTGCTACTCCGACT
GTGTGCTTCGCGTACTCTCTTTTGGGCTGTGGATTTTCCGCGCTTTCCATCGGTTCGTCTTCCGCGTCTGGTTACCCGTAGTCCCCAGTCGCGCCGTCGT
CGTGCTCGTGCCTGAACGCTTCTTCTCCTCCGTCCCTCTCACCG