Description :
From Genome Similarity Track
Location :
Scaffold_357:18224- 20120
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_357-abinit-gene-0.25Syntaxin 7
Pytiw_DAOMBR242034maker-piw_contig_357-fgenesh-gene-0.5Conserved gene of unknown function

Sequence
1896 bases(100 bases per row)
CATGGGCGACCGGTACCAGGCAGCGCAGTCGCCGCCGCGCAACCGCGAGCGCGGGCTCTCAGACGAGAAGTACGCCAAGCTCATCCAGGAGACGTCCAAG
GGCATCTCGAGTTTCAACCAGCTCACGCGCTCCATGGCGCAGAAGATGTCGCTCTTCAACACGCCGCAGGACTCGCGCGCGAACCACGAGGCTCTCAAGG
AGCTCACGGACAAGGGCAACAAGCTCGTGACGAAGATTAACCGGCGTCTGCAGGAGCTCAACAAGTCGAGCCAGGGCGCGAGCGCGCGCATGCGCAAGAC
GCAAGTGGCCAAGCTCTCGAGCGACTTCAAGACCCAGATGCGCGCCTTCGAGGAGACATGCGCGAAGCTCATCGAGTCCGAGAAGCAGTCGGTCGAGTTC
ATCCGGCGGTCGTCGCACTCGTTCAACCACAACGACGCCAAGGCCAAGGTCGAGTTCTCCAACTACAACGAGGACCAGATCTACGCACAGGCCAACATAA
TCGCGTACGACGAAGACGGTAAGCTTGTGTATGTGCTTGTGTTAGTATGCGAATGTGCTAACGTTGCTGCGATTGTTTGGATGTCTAGATCTGGCACGAA
GAGAGGAAGACATCATTCACATCAACCACCAGCTTCGCGAGGTGAACGCTGCCTTCAAGGAGATCGACGGACTCATCGAGGACCAGGGCGAAGTCATTGG
TGCGTACTGTTTCGTTGCAATGCGATGGCGTTTGTGATTACAGTGGCGCTAACAGTAGCGGCTTGTGATTGATGTGAAATGGCGCAGTGGAAATCGAGGA
CAACACGGAGGACGCCAAGGTCAACGTCGAGAACGCGCTGAATGAGGTGCGCCAGGCAGACCAGAAGGCCAAGTTCTGCACGTGCTCTAAGTGGAAGCTC
ATGTGCTACGGTGGCTTCACAATCATCATTCTGCTGGTCATCGTGGGCCTCGTGGTCGGCCTCAAGTAGTCCGTACGTGGGAGCAGGTGCCTCTGGCGCA
TGAAGAGGGAGACAAGCAGCACGAGCAGCAGGAACGATCCTCTCTCCTTCAGGTGTGCGCAATAAATTAACTTGGTTGCATTGTATTCTGATCTTCCTGG
TGGTGCTCTGCGTTCTAACAGTCTCTATGCGTGATAGTATTAATTGATCTGATATTAACTGTTGTACCTGCCAATGAGCATGCCAGTGCTGTCCATTCAG
CCTCGTCGTCGCTCACAATTGCTGTATCTATCTATATCATGCATCGCCGCCGGACATGCGTCGGACCTTGGCGCCGATCTCCGTCACGAGGTGCGAGCCG
CGGCGCTCGAGACGTCCGGCCTCCTTCTTGGCGCGGAAGATGCTGGTGGCCACCGACATGATGATGCTGCCCACTGACCCACCCGAGTGCCGCCGCCTCC
TGGTCGCGACCTCGTCTCCGCCAATGCCCACTGGCCCACCAGCAATACTCGCAGCAGCGCCAACGGCAGTGTCATCCTGGTAATGCGAGAGGCGGTCCGT
GCCGCCCGAGGACGAGCCCATGCGCGTGCTGGCCGACTGGAAGCGGTTGCGCGGGTCCACTGAGAAGATGGCGGAGAACGGCACGTGCTCGTCGCGCTCG
GACGAATCGAAGTGCACGACGCACATGCGCTCCTTCTCGCGCACGCCCTCGACCCAGCCGCTGTAGTACTGCACGCTCCCGTGCACGCGCGCCATCACGG
CCTCGCCCACGACGAAGGTCACGGGCGAGATCTCGAACCCGATCGTGTCGATGCTGTAGTTCGTGAGCCGCTGCGTGGGCGAGAGCGCGTCCTGCAGGTC
GATGGGCGCGACCTTCTCCAGCGGCACGTTCGCCTTTTGCTCGCCGTAGTCAAACACGAGCGTGTAGAGCGACGACGTGCCCTCGGCGGTCGTGGC