Description :
From Genome Similarity Track
Location :
Scaffold_1622:1822- 4242
Transcript NameFunction/comments
Phyra_87161reverse transcriptase

Sequence
2420 bases(100 bases per row)
TCATGCGACTGCATGACTCCAAATCGGTTGCGGTTAGTTACCCCACGTTCATACTCACGCAACAATGCTCCGCAGTTGAGGTCGGCCTCGTCGACCCATG
ATGGATCTTCGAAGCCCTTCCAGTACACTTGGAACTCTTGATGAACTCGCCCATAGCGCGTACGCCGCCCTGATCACACATCCACAATCCTGTCAACCTC
GTACTCGTCTTCGCCAAGGCTGCGTTCCCAACTATCTTCTGGCAGGATTGCTTCGTCAAAATATTGCTTCGTCAAAATCGAAACGATCGCCTTCAGCCAC
GGTAAGCACCAACGTAGGGCGATCGGGAAAACTTCGCACCAGCTTGAGCTTGGACACGTGAACGATCGGGAATAAGCGGTACTCCGTGCCGGCAATCTCC
AGTCTCGCTGCGTGATTGCCTACCATCTCGACTACCCGGAACGGGCCGTGCCACATATGCGCCAGTTTTCTCGCGTAGCCTTCCTTCACCCGGTCCAGAT
ACAGCCAGACTTGTGCACCAGCCTCAATCTCCTGGGATCGGACGTTCTGGTTGTGTTCGTCGGCCCGCGATTGGATCGCTTCCCGGAGCCGCTCATTTAC
CTGCTCCCTAGCGCGCCGATATTGACTTTGCATGTGGAATCGCCATCGTCGTGACTCGCGATCACGCCGGCGCGTGCTCCCGACGGGTAGCGCCGCTTCC
AGCGTGGATCGTGGGTCCCATCCGTGGATCAGATAGAACGGCGTGTCTCCACGCACACGGTCTTGGGCCGTGTTGATCGCGATGGTGAGGCGTTCTGCGT
ACTCGTCCCAGTTTTGTTGGTTAACGTCTGCGACGTACATCTTCAACGCTCGAGTCAACGTCTGCACCATACGCTCGGCTGTTCCGTTTGCTTGGGGCCG
GTACGCCATCGTAGCCCTCTGTTTTTGTCCCACGATACGGATGAATGCACGGAAGAAATCAGACATAAAACCGGGTACTCTGTCGTGCCGGATGGCTTCA
CTGGCTCCAAAACGGCGGAATACACACTCTTCATAATTCTCCGCGATCGTCTAGGCCGTCCTTGACGCACTTGCTTTCGCGATCACATATCCCGAGAACA
GGTCTACCCAGATCAGCAGCTCCGTGTTGCCCTTGAAAGACTTGGGCAGCGACGGAATGTGATCCATCGCGACAATCTGGAACGGGTACGTCGCTTGCAA
GTTTCCCGGGGACTCCCCTCTCACGAAGGGTCGCCCTTTCCCTGTCTCACAGTCTGTGCACTCTCCCACGTAGCGTTGGACACTTCGGTACAAGCCTCAC
CAGTGAAAATGGGATCGGATTCGTCGGTACGTTCTTCCGATCCCCTGATGCCCTCTTTCCAGACTCGCATGATAGTGATGCAAGAAATCTTGTTGCAGAG
TCTCTGGGACCACCAACTTTGCGATCTCATCCCGATCCTCGTCCTGCTTCATGGATGATGGACAATAGAGCAACAAGTCGCTCTCGTCCAGCTCGTAATC
GTCCGCGATCTTAGCACACGACTTGGCTTCCTTCGCAGTCAAGCTACCGACGTCTCCTTTCAGGTACGCCTTTAGGTCGGTGATCCAGTTTCTCCTCATT
CTGGGCTTGGACGACTCGCTCACTTCGCACGCGCTGAATGATCGTTTCCTGCAGAGCCTCGGGCGGCAATCGCCAACGCCGCGTTGATCTAGTCACCGCG
GACACACGGACAATACCGTCGTCATCCTTTGCCTTGAGAAGCTCATCCAGACGGTTAAGCGTGATCAAGTCGTGCCGATCATCTTCTGAGGTAATCACAG
TTCCTTCTTCTTGTTGGAGAGCGGCGCTCGCTAACTTGTTTGCACTCTGATTCCAAGCTCGCTTCATGTGCAGGAACTCGTGTTTCGGCCACAATTTGAG
CCGCTCCATTGCCTTTTGGCCCAACAGCAACAGGCCTGAAGCTTTACACGCGATCTCACCACGCATCTGGCGGATCACCAGGTTGGAATTACGGCAGATC
ACGATCCGCCCCGGTCCAAAGTCGATAGCAGATCAAAACACAACAACAACCCGCGGTACTCAGCTTCGTTCACGGTCAGATCGGGCATGTACTCCGACGC
GGCTGACAAAATCGTCCATTCGGGGAGCTTCTATATGATCGCGCTGTAAGCCCCACCGCTACGTTTAACACGTGCTGATCCATCGAAGCTCGCGACTAAC
AAATTCTCGTCTGCTTCAACCGTAGGGGATGGCATGAGGATCGTTTGTTGAGGTTGTTTCACCGGCGCAATCGCGATCAGCGCTTCGTCTACTTCAGCGC
GAGGTGTGATGCTTGCTGCAATCGCACCCAGGATTTCATCTTCCCCTTTCGTGCATTTCCGGATCTCTAACGTCCACTCTGAGAGCAGCGCAGCCCAGTT
GTCGAGTCTTCCCTGGAAAC