Description :
From Genome Similarity Track
Location :
Scaffold_1696:1822- 3946
Sequence
2124 bases(100 bases per row)
GCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGG
ATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGA
TCTGCTAGCGGGGCCAGCTAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTAT
GGATTGGGAGTGTCGGTGGCACGACAATACTACCACGCTCGCCGCAGATCGGATGAATCCCCGCTAGAATACCTACATCGACTAAATGTGGCCGGTCTAC
GGGCCAAGTTGAAGATCAAGGATGGGGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCAAGACGGTGGGAGACGTGGATCTGGCCGACAGGC
TGACCCTGTTACGACTTCCCGACGCAGACGAGCTTGAGGAAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGATCGGATCCG
GCAAGTATCGCCAAAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGTTCACCAAGTCACGGCGCCCGACTCAGGAACTGAATCAGGATCCGACGGTTC
GGACTCCGACCCTGAAGATTACCGTCGGGTCTGTCTCACTGCATCCAACGATCGAACGGCGACGACAGGAGACAACTCTCGACCGGGGGATACCGTACCC
GAGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCACGGTGCGGATCCCGGAAGCACACCGAATCTGGATGCT
GGAAGCAGCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAA
GTGCCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATTTAGCCAAGCACCGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGTTAAACTAG
GACGTTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCT
AGATCCAGTCGATAATACATGTGATCTACATGAAGTGTCGGTTGCCAAGATGCTTCAAGTGGATGAGTTTGCCAGATCCGAAGTTTCTTCAACCCTGGAT
CTACAAAGGGGAGAGGCACGTGGTTATTGGGAGAGGCGCCAACATGGCCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCT
GTCAGGTCACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACCGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTG
GTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATTCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCT
CGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTATACCGTACGAACGGGAGAACGCGAATCAAGATCA
TGTTGGCAGGTTGTTTGGTGTACTGGTTTGATATTTGGGTTGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCAGCCGGAGT
GAGATTGGATTTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGTAGATCCAGCTCAGCGGACGGCGGCCGTTGTATGGAGCGAAGATGAGGATCATA
AGGGCGGATAAGACAACCTGTATCGAGCCCGGGGAGACCTGGGAACTGCCAGATCGGTTAATGTGAGTGGAACATGAGAAACCGTGGGTCACTCGGGGCG
AGAAATGGGTGCCTACCGTAATCCAGGGACCAGGTCGATCACAATACCTCCAGGTCACGAGCGTCAGCGACAAGAGACTATTACTGGACCATTATGAGGA
GATCGGACGATGGTTGGCGAAGGA