Description :
From Genome Similarity Track
Location :
contig_7:182112- 183201
Sequence
1089 bases(100 bases per row)
GTAGGTAAAAGTTGATTAACTTTAGCTGGACTTACGTCTTGCAGACCTATGCTATTACTAGTGTCTTACGTCTAGCATCGCGGAGTCCATATTCGTTGTC
GTGGGAGGTTAGGAAGAAGTGCAGTCTGTTCTGACACGAATCCCAAGCGCGTAAGCACTCGATTAAGCGCTCCGCCGTCAATATTCCAATCAGATGAATG
CCGAAACAGGAAATGGCAGTGGCTTCGAAATGAAGCCTGCAAGTTAGCGACATTTGGCGTCACCGCTTGTGTTTCGCCGAAGTAAATGTCATTGCGCAGC
CGCCACGTTGCGTGAAACACTATAGCAGTGTGCATTCTCCACAGTAGCAACAGGTTCTCCTGATCGCCTCTCCATCCTCTAGCAACATCTCTGTTGGATG
GGAACAGCAGAAGCTTCCACTCCAAGGTGCTTCGAAAAGCCCTTCGCCATTGACTCCACAATATTTGCCACATTTGCGTTAGCGCCGGACAAGTGAGAAA
ACAATGTTCCAATGTTTCAATTGAATCGCAGCCGTCCCGGACACAAAGTTGTGCATTCGGATTGCTAGTAAGCATGAAGAAGAGCCTTGATCCGACAATG
AGGTCTCCAAAGAATAGCCTTAGCATTAAATCGTGAACGACAGGTACCAGACACCGTCGAAGCCAAAGTACCTGAGTAAGCGTTTGATGTACACGCCCTC
GGGGACATCCAAGTTGTATCATTGGGTGTTGCTCCAATTCGTCGAGAGGCTGGATGAGTTTCTTCCAGTCTCTGGCTTTTAGGCCAGGAAAGAACCGTGA
TCGTGATCCTTCAGGAGTGCTTGCAGTCACCACCACCCCTAGAGATGGAGGTGTTGTATTGCTAACCGCCCTTCGCAACCCACCCGCTTCCGGGTGAGGA
AGAACCCGCTGATAAATACTTCGCATTTGATAGTAGAGTACGAAAATATCGCGGAGCAATATGCGTGAACCCAGCTCGGGTTCCACGATGGAACAAACCA
TTTCGAAAAACTCCCCTGAACTTAGCCAGTGGCGATCATTATCCAGAAAATCAGCAAGGCAATGCTTGTTTGCCTTCGCGAGAGCCCGA