Description :
From Genome Similarity Track
Location :
Scaffold_183:1821- 4296
Sequence
2475 bases(100 bases per row)
AGGGAGGTAACGGTCGTGGGACCCCGTTACACCCTCCGTCCTTCTTAACCTCCGACAGGGGTGTACGTTATAGAATTGGCCTGGTTCCTAAAACCAAATG
TTGCGTTACACGTCAATGGCCTTTACTAAAGAAAACTGCGATGTTATCGATGAATTCTTTCGTGCAGAGCGCGCGGCAGGCATACTTCGCGAAAGTAAAT
TCCCTCACTCTACGACCATCTTCTGTGTGAGGAAGCCAAATGGTAAGTGGCGCATTGTACATGCTTAGAATAAAATCAATGCCGCTACAATTTCAGCACA
AACACCGCTAATGAAACGGATGTTTTTCAGAAATACATGGTTGGTTGCACGATGTAAATGCACTTGACCTGGTCGATGGTTATCAACGATTACTCATGCG
AGCGAGCTATATTCCACCCACAGCGGTTATGACCCCGAGTGGTATGCTTTGGGAGCTGCTAATTATACATCAGGGGATATATAATTCCCTGGCGACTTTT
AATCGTCTTGTGACACATGTGTTCCGTCCTCACCGATATTATACACATACTTATTTTGATGACTTCTTTTCCGTAGTCGAGCAGAAAACGGGAAGGCAGA
TGTGGAAATCACATCGATCACTTGCGAGCAGTGCTCGAGTGCATGATCATTAATATGCTATATGCCAATGCATCGAATGCGTATTGGTGCTGTAGAGATA
ACCTTTCTGGGGTGCTCCATAAGAGAGCGTGGACTAAGGACTGACTCTGTATATGTTAAGGCCATATTTGATTGGCCGGTCCCTCAGAACCGGAAGGACT
TGCGTTGATGGCTTGGCCTTGCAAATCCCTGCACAAATGTAGTGCAAATTACGCTAATATGGAAAAGCCATTGTCCAATCTCCTGAAAAAGGATACAGAA
TGGTTCCAGAGTAGCGTTGAATATGAGGCTTTTACTGCCGTAAAGAATATTCTCTTTTATGTATCGATTTTGGCCCTGCCTGATCCAGCGAGGCATTTTT
ACTGTCATCTGTGACGCATACGACTTTGCTATTGGCAGCTCTCTGTCACAAACATATGAGGAAGGACGTGAGTGTGTCATCTCCTTTGAGTCTCGCCAGC
TTAAAAGCAGCTGAAAAGAACTATCCATTTCATGGAAATAAGTTATTAGCTATGAAGTATGCTCTAGTCAATTTTAGCGTACATCTGCTGGGCTCGAAGC
CATTTGTGATCTTTACTGATCATGCGTCACTACGCACTGCCACGCAGTCCCCCTCGCCTCTCAAAAAATTGGACCGTTGGTTGTCACTGTTTGCGAAATA
CAACTTCGCGATGAAATACAAGCCTGGAAAACAGAACGTTTTAGCGGATACGGTATCACGCATACCTGGATATGTGCTTGCTTATGTTACAACATTGTCG
TCCTACAATTTCCGACTTAATTCGTGTAGCTTATGCCCGTGATGATCACTATAAAGCTTTGCTATGTGCTCTCGGAAGCGAAGAGTTTGAAGACTCGGGC
TAGAAATTGTCGGCACGATTGCGTGCTCGCCTCCACCGATATAGTCTCAGTCCGAGTCTCTTGTGCTATCGCATAGATAATGAGGATAGTCCTCGCATTG
TGGATCCACGTGATGAGGAGTTACAGTATCTCATTCTTTACTAGGCACGTAAACGACGATAAGCGGTCATTTTGGTCTTGATACGACCTATCACTTATTG
AGTCAGAGTTAATGGTATCCCATATATATATATGCGGAGGGTTTGACCCGTTGGCACATGCTGCTGCACCACTAGCGAGTCTACCTGTCCCCAAAGGGTA
TTGAGAGTCCATGAGCATGGATTGTGGTTTGGCCGTACAAAATATTCGGATGGCAGCACAAATATTGTCGCATGTGTTGACCGCTTAAGCGAGATGGCTC
AGTTAGAGGATGTGCCAGAAGCAATTGGCGATAAGTTACAGCTCAGATGTTTATCGATTGCGTGTTTCGCCAACATGGATTGCCTCGAGAAATTGTTTCT
GACCGCGATCACGTTTCACGGGACAATTTTGGAAGTCCATCTTCCAGGATTTTGGTACTCGTTTGTACATGTCCGCCGCCGATCATCCGCTGAATTATGG
CAAATCGAACGCGTTAATCGCGTTGTGGAATATATTCTACGTAGCATATGTGCCGACGCACCACGGCATTGGGGCTCGATACCCCCTGTTGTTGAGTTTT
CTCTCAATAACGCTGCGCAAGACTCTACGGGCTAAATACCATTTTACTTCAGCGTCCTCACGCACCGCGCGTACCGTTTAATCTCCCACACCGTACGCTT
GGGCTTGGTGAGGCAGAACTTGCAGACCGGCTTGCTAATGTCAGCAACATTTCTATTCAGAATCAGGTGCGTGCGATCATGACTACGCGCTTTAGTGTTT
TTAAGACATGTGCAGGGAGCAATGACTGAAAGTCAAGGTAAATAAAAGTAACAAGCGGACGCTAAAAGAAGAGGA