Description :
From Genome Similarity Track
Location :
Scaffold_2708:1821- 3094
Transcript NameFunction/comments
Phyta_totarag14762hypothetical protein

Sequence
1273 bases(100 bases per row)
AGGAAGGAGGAGAGTTGTTCgctgaagacgtcgaaggGCAGATGGCAGTGTTACCAGAAATTACGGCAACTACCGAGGAAGTCAAGATCGAAGACATTCA
GGTAGGAGATCTCAGCGACAACACGCCGGAGGAAATTGAACGATTACGACAAATCGTCTGGCGTCACCGACATCTCCTAATTGGGAGAGGTAACGCCTTA
CCGCCGGCTGCGAAAGGGGCGATATGCGACATAGACGTGGGAGGTGCTAAACCCGTCTACCAGCTGGTGCGGAAAGTCGCCCCGCAGTTCCGCGAAAAAT
TGTTTCAGCTGATCAAGGGCCTGCTGTCTGCGGAGATCATCCGACACTCAACTTCACCCTGGGCCTCGCCGATCGTGatcatcatcaagaagaacggagT
CGACATCAGGCTATGCATCGATTATCGGTTGGTCAACAGCCTGTCGCGACTGATGGTGTACCCCATGCCGCTGATCAACGTTCTGCTCGACGATCTCAAC
AAGATGCTTTGGTACTGTTCATTAGACATGACCAGTGGTTTTTGGGTTGTGTCTATGACGGATCGGGCTCGCGCGATCTCAGCGCTCATTACTCCGTTTG
GCCTGTTTGAGTGGAACCAAATGCCCTTCGGATTGTAGAACGCGCCGCAGATCTACCAGAGACGGTTAGATAATGCTCTGTACAGTTTCCTCAAGATTAC
GAATGACCCTGATCGTCCTAGCCAGATCGACTTGTTCAAGGAGGGAGTGCCAGACACGGAGAAGGAATCGTCTGTCATCGGTCGTCGATCTTATATCGAC
GATATCCTGGTGACGTCCAATACGTGGGATAAGTTATGTGCCAAGGTTgacaagttgctggacgCATGCGATCAGTGGAATTTGTCGATCAGCGTCGCCA
AGAGCTTTTGGGGCTTGCGAAAAGTGGACTACCTCGGACATCAAGTATCGATCGAGGGGTTGGAAGCTCACCCGAAGGAcctgtcgtcgctgcttgaTCT
ACCGTTCCCCACGACATTGAGATCGATGCAGTCCTTCTTGGGCAGCCTCAACTATTACAGCCGCTTCATTGAAGATCTAGCGATCTACGCGTCAATCTTA
TATGAACTCCGGGAGGCCGAGTTTTACGAGATCTCGAGGAAATCCAAGCGTGATCTGGGAAAGGAAGGCGAGGATCAACCCAACGAAGCCGGGAAATGGG
ACCAGGCGGCTGTGGCATTTGCTACCCTGAAGAATAAAATCGCTACAGCACCCATCCTACAACACTTCGACCC