Description :
From Genome Similarity Track
Location :
Scaffold_34:182098- 184149
Transcript NameFunction/comments
Physo_134809hypothetical protein

Sequence
2051 bases(100 bases per row)
CAGCGCGGCAACGACTCCGATAGACTCGAACGATTCAAAATGGCATAGATCCACGGTGTGCACACCACCGGCTGGTTGTACACGAGAGCCCACAGCACCT
TCACCGTGGCCACAATGCGTCCAGGGTCCATAACGCAGTGCGTGGCATCCTTGCTCTCGCTTGGAATTAAGTGCATGCCGACGCGCTGGCACGCGTCGTT
CACCTGCGGTCGACTGCCCCGCTGGATGCGCGAGGCCACGAGCACGAACACTTGGTAGCGCACACGCAGCACCGTCTTCTTGGCCCCGAAGGAGATCTGA
TCACCGTGCCGCAGTTGCCGCGTCCCGAAGCACTGCTCCTGGTTCACGAAGGAGCCGAAGCGCGACTTCATGTCCACCAGCTCCAGCGCCGGCCTCGTCG
ACGGGTCTCCCAATTGCTCTAGCGTGAGAGACCCCACGCGGATCAGCGCGTGTGTGCGCGAGATGGACGCGTCCGCGTGGAAGTTGAAGTGGCAGCGCTT
GCGCCCCACGCTCCACTCGCCCGCCACCAGGTAGAAGGTCGTGCCGGCGCCTGCCTCGCCTGCAACAACATCCAGGACCCACATTTGGCTAATGGCACTT
TTCGTGATAATCGACATAACCGAAATATTATACTTAGTCTGATCCGAATATTTCATTGAAGTCAAGCGACTCAAGTTCACTAAAAATGTGCTGCCAGACC
TTATCCTCCTACAACACGTTGATCCAGCGCTCCTTCCGTCGCAGCTTGCGCGTCAATTTGCCACGTCGTTCTTCCTCAGCAAAAGCTCGCAGCGTTCAGC
GGCACTTTTGCATTAGGCACCCTCACCAAACGCCCACTGAAACAGAGGGGGTGGTCGCGCACTGATTGCAGTGCCAGGAATCGTCGACGGGGTCACCGCG
ACTGGCACTGCCATTGGGAGCGGAAACTGCATGGAGCGTCTTGCAGACGACGCGGCTTCGGCACCCGCCAGACCTTCCGAGTCAGTGCGGCCAGCATTCT
CCTCGCTGCGAGGTGAACTTGATCGAGTGTCGTCGTCCTCAAATCCACTCAGGTTCACCTCATCGAACTCGGCTCCGTCGCCGCGAAATGGCGATTCGAA
ACGGTGGATGCTTGATGGGCTAGCTTCGCGCTGCGGCGAGAGCACTCGGCAGTGGCGACGAGATGGTCCTAACGTTACAAGCATACTGTTAAAGCGAACG
TGACGCACACTTGATTAATAAGCACAGCGTGCGTGCGTACCGTGCAAATCATCATCAGATTCGTGGCGCTCGCGCCGCTCGTGGTATGGTCGCGAGTGGC
GACGTCGCTGCGAGCGGTGGGTAGGCTGGCGAGTCGATTGCATTTGCAGGTAACACCCATAGATATCAGCTGGACTGAGACGCGCTGCTCCACTTGCTCG
TCGCGCCGCCTGGTACTTTACTCGTCCCCACAGGTCATTGATCCAAATAAGCCGTGTCGATAGCTGCTGCAAGTCCCCGGACACGGTTCCGCAAAAGCCT
AGATGTATTGTAAGTACACACAGCAGGTCGTTGACTAAATGACTCTCACGACTGCAAGATACATAGTACCTACCGACAACCCATACTTCCTTGCGCAGCG
CATTGCGAACGAAGCCCAACGACGTGTAAAAGTCACCGTCACCACTCAACAACACCACGCGATCAATGTACTGCACGCAAATTCAGACACAATTTTGATC
AGAACTCTCTTGCAGCACGCCAGATTACCTTGCAGTTCGTACGTTCTGCGTCGTTAGTGTTAGAAGCTTTGTAGCAATCCTACAGAAACAGCGGAAGCAT
AACACGACACGATTAGCTTGATGAGAGCCCACATTTACTGCTTCTCAGTCGTACGCGTTGTCGACGCCTTTTTGGACGTTCTGGGTGAATCGATGTCCGC
ACTTCGTGCACCGGCAATTATACTTCTTCGTCGAAAACACCTCAACTTGAAACTGTAGCAAAAGCGTCGACTACATAAGTGCATGTACAGAGAAAGAGGC
AAAACATAGCAGAAATCTCTACCTGTGGTCCGAATGGGCGCGCGAATTTAA