Description :
From Genome Similarity Track
Location :
Scaffold_16:182035- 184898
Sequence
2863 bases(100 bases per row)
AGAAGAGTTGAACTCGTCCTCGCTTCTGGATGAAGCTGTCCTGGAAGACACCAAGACGGCGCTGAATGCGCGGAGCGGATCGGCGATCCTGAAGGACCCG
TCGGATCCCTTGCATCAAGTGGTAAATGATTACCAGGACGTGGATTCGAAGGAGCCGCCCTCGGGGCTACCTCCGGATCGAGGTGTTCGACACGAAATCG
ATCTCGTTCCGGGAACGAAGTACTGCGTGACGAGGCTGTGGCCCTTGCCGAAGGAGCCGTGTGACGTCATTGACGCGTTCTTCCGTGCGAAGCACGAGGC
GGGCATGGTGCGTGAGAGTAAGTCTCCACACTCTACGCCGACATTCTGTGTCAGAAAGCCGAATGGCAAGTGGCGTATCGTGCATGCTTTCAACAAGCTG
ACTGCCGCTACCATTCCGGCGCAGACGCCGATTCCTCGGAAGGATGTTCTTCAGAACAACATGACAGGATGTACGATGTACAGTGCGCTCGACTTGGTCG
ATGGATATTACCAATTGCTCATGAGGACGAGCGACATTCCTGTCACTGCGGTGAGTACTCCGAGCGGCATGCTCTGGGAGTGGTTGGTGATACCCCAAGG
GCTTTCGAACGCGCCAGCGACGTTTATTCGTCTTGTGACGCAGCTCTTCAGGCCCCATCGGGCGTACGCGCAAACGTACTTCGATAACATCTTTGTCCAC
AGTCGTGCGGAGCACGAAAAGACTGATATGGAGAACCATGTGGAGCACCTGCGTGCTGTGCTCGAATGCATGCGTCAATACAAGTTGTACGCCAACATTG
ACAAATGCATCTTCGGAGCGGAAGACATCCTTTTCTTAGGGTGCTTCATCGGGAAGCGTGGCCTGAGGGCCGACCCGGTCAAGGTCAAGGCCATTGTTGA
CTGGCCGGTTCCCAAGAACCAGAAGGATCTTCGCAAGTGGCTTGGCTTGGCCAATTACTTGCACAAGTACAGCGATAACTACGCTGAGATGGCTCGGCCA
CTCTCCAACCTCCTAAAGAAGGATGCGGAGTGGTGTTGAAACACCGAGCATCAAGATGCGTTCGCGGTCATTAAGGACAGTCTCCTTCATGCGCCTATTC
TGGCTCTGCCAGACCACGCTCGTCCGTTTAGTGTCGTCTGTGACGCCTCGAACTTTGCCATCGGCTGTGCACTGCTGCAAGCAGACGCCGAGGGACGCGA
GCGCGTGGTGGCGTTCGAATTTCGCCAGCAGAAGGCTGCGGAGAAGAACTATCCTGTCCATGACAAAGAGCTACTTGCGATGAAGTATGCGCTCGTCAAG
TTCAGGGTGCACCTGTTGGGCTCTCAGCCGTTCGTGATTTACACGGATCATGCATCGTTACGCACTGCGACTCAGTCGCCTCACCTCTCGCAAAGGATGG
CCCATTGGCTGTCCTTCTTCGCGGAGTACAACTTCGAGGTGAAGTACAAGCCTGGCAGGCAGAATGTCCTTGCGGACGCGCTGTCGCGCAGGCCGGATTA
TGAGCTGGCTCATGTAACGACCGTGACTTCGTCATTTTTTCGGATTTGATCCGAACGGCTTATGCCAAGGACGACACCTGTGTCGCATTGCTGAAGGCTC
TGGGGAGCTAGGAGTTTCAAGACTCGGACATAGAATTGTCAGCGCGGCTGCGCGCGCGGCTACACCGCTATTCCCTCGATGGTGGCCTGTTGTTCTACAA
CACTGACCCCGAGGATACGCCCCGCGTGGTCATCCCTCATGATGAGGATCTGAAGTATCGCATCCTCTATGAGGCACACGACACGTCGCTGGCAGGCCAT
CTTGGCCGTGAGAAGACCTACAGCTCGGTGAGCACCCACTACTGGTGGCCGAAGATGTACAAGTGGACGAGCACTTATGTGCGCACGTGCGAGACGTGTC
AGCGCGTGAAGTCGTCACCTCATACTGCAGCGCCGTTGGCGAGCTTGCCTGTCCTTTCGGGCTGTTGACAATCCATGAGTATGGACTTTGTGTTTGGCCT
GCCGGCGGACGCGGCGGGCAACACTGGAGTCGTGGTCTTCGTGGACCGACTGAGCAAGATGGCTCACATTGCGGCTGTGCCGGATACCATCGATGGTAAA
GGTACAGCAACGCTGTTCTTGGACCGAGTGTTTCGACAACACGGACTCCCTGAGTCGATTGTCTCGGACCGAGACCCCGCTTCACGGGCAACTTCTGGAG
CGCGGTCTTTGCGGTGCTTGGCACCAAGCTGGACATGTCCACGGCGGACCATCCGCAGACCGATGGTCAGACACAGCACGTGAATCGCGTCGTCGAGGAC
GTGCTCCGCAGCATTTGCGCCGAGACGCCGAAGCGCTGGAGCGCCATGCTGCCACTCGTTGAGTTTGCGTTGAACAACGCCGTGCACGCCTCGACAGGCT
ACACGCTGTTCTACGTGAACAGCTTATCTCATCCCCGCGTCTCGCTGACGCCGCCACGTGGTGGCCTCGGGCTTGGTGGGGGAGGAGAAGCCGATTTAGC
TGATCGGTTAGCCGATGTCAGCCCGACTACTGTTCGTAAACAGGTTGACGCTTTCTTGTCGACGCGTCCGAGTGTCTTACGACATGTGCGTGACGCAATG
GCTGAGAGCCAAGACAAGCAAAAGGAACATGCAGATGCCAGGGGCAGAGGCAATGTTGCAAGTTATGAGGTCGGGGACCTGGTGCTGCTTAATGTAAGAA
CCTACCTACACATGCAGTGTCTGCCGTCTTCAAGACGAAGTTGCGCCCGCGCTTCATCGGACCTTTCAAGGTTGTGGCCAAGAAGGGCCTTGCGTACACA
CTCAATCTTCCGAAGAAGATGCGGACGCACCCCGTCTTCTACGTGGGCTTGCTCAAGCCGTAC