Description :
From Genome Similarity Track
Location :
Scaffold_8:182014- 187567
Transcript NameFunction/comments
Phyci_101488mitogen-activated protein kinase, putative
Phyci_90124Hypothetical protein
Phyci_77190conserved hypothetical protein

Sequence
5553 bases(100 bases per row)
TCACCCCAACCTACACATCCCGATAACGTGGCATCGTAGATGCGCTTTCATTGGTCGAGTCTTGGTTGTAGGATGAGCTGGCTAAATATAGAAGGGGCCA
GTAGGCGCCTCTTCGAGGAGATCCTCACCTCCGCATAGTTGCCGTCACTTCAGCCCCCGCCATCCCGCATGACGCCGACGCCCCCGTCCTCGGCGCCGTC
CTCGCTGCTGCGCCGCGCGTCGTCCCCCGTgcccgcgcgcccgggcagcggcggcgcggccggccTGCGCTCGCAGACGCTGCTGGCGCGCCTGTTCCGG
CGCAAGGAGCAGCAGCGCTcgcccgccgcgccgcggccgcTGAGCCGCTCGCTGTACGGCGAGGAGGAGGAGAGCAAGGCACACGTAGACTCGCCCATGC
GCGCGCTGCTGCGCTCGCTCAGCCTGCAGCGCAAGAGCCGGCCGCGCACGCCGCCCGCCGACGCCGCGCTGGTGCTGCTGGAGGGCGTGCTCACGGAGCT
GGCGGCGCAGCGCTACTGGCGCTCCAAGCCCTGCTACTTCGTGCTGGAGCAGGCGACAGCAGCCGGCGACGCGCTCGCGTTCACGCTCCGCCAGTTCCGC
TTCCTGCCGGAGACCAGACGGCCCGGCCGCCTCGTGGCCGTCGTCACGCTGTCCGCGCGCGACGCGGTCACGGACCTGCGCACGCACCGACAGGTCAAGC
ACGCGCTGGAGCTGCAGCTGGCGACGGCGGCCCAGCGCGTGGAGGTCCCGGGCCCTCGGAACGAAGACGACAGAGAGGAGAGCACGTCCCAGCTGCTGCG
CCTCGCGGCGGCGGACGAGAAGACGCTCGCCAAGTGGCTGCAGACGCTCAGCTCGTGCATCGCCAGGCTGGCGGTGCAGGACGAGGAGACGCAACTCCTG
CGCGGAGACGCGGCCGCGTGGGACCCCGTCACGGAGCCGGCCAAGATCGTGCCCATGTTCGGAGACGAAGGCCGGCGGTCGAGTGTCCTGGTGACCAGGG
ACCGCGACCACAACTTGAGCGGCATCAGCTTCACCAGCAGCGAGTGCAGCAACAATAACCACTATGAAGGAGACATCCCCGCCGAGGAGATCCGAGCCGC
GAGAAAAGATGCCGGGGATGAAGAGGAGGAGACGAAACTGCCCGCTGATGAACGCTGCCATGACAGAGTTGTTCCAGCTATAGGGGATGAAGAGCTGCCG
CCGCGCGGAGCTGTGGAGTATTGCTGCACGCCGGAGTATCGATCGAGTGGGTCGTCCAACTCACAGGGCCTGGACATGGACAATAACGCTGCTGACGAAA
AGGGAAGAAACAACCAGGAGGACAACCAGGGAGAAGACGACTCCGAGGAGGATTCTCTGGCTGGTGACCTCGCCACACAGAGTTCGGTGGCTCCGTACAA
AAGTGCAGTTTTGGCAGGCAGAGGTGTTTCTGCCTACCAAAGTGTGGGCCTGGAGGACGAGTACACGAAAGCGAGCTCAAGGTCGTCAGTAGCAAACGGA
CGCGGTCGTCTCCCTCGCGCTGCTTTTGGCGCCACCACTAGCAGCTCTGGTCTACTCCCGATGCTGCGTCCGCAGACACATTCGTTCAACGCAAACGGAC
AAGTTTTCACCCTGGATACTCGCTATCAGCTAGTCAAGCCTATTGGTAACGGAGCTTACGGGGCGGTTATCGCAGTGAAAGACGTAGTGAACGGTGGTGA
GAACTTGGCCGTTAAGAAGATCACCAACATCTTCGAGGACCTGGTGGATGCAAAGAGGATTTTACGTGAGGTTCGGCTGCTAGGCCACTTCAGCCACAAG
AACATAACGCGGCTGCTGGATCTGTCGCCCCCTCCTTCTCGCAAACAATTTGATGACATGTATATCATCACAGAACTCATGGAGACCGACCTGCACCAAG
TTATTTACTCCATGCAACCTATGTCGGACGACCACGTCAAGTACTTTTTGTACCAAATGCTTTGCGCGCTGCACCACATTCATTCGGCCGGCGTGCTACA
CCGCGATATGAAGCCCAGCAATATTCTGTTGAACGCAAACTGTGACCTCAAGGTTTGCGACTTTGGCCTCGCTCGTGGAGGGGTTGGCGGACAAGAGGAA
CTACTACAGCCAGGCGAGCTAACCGAGTACGTGGTCACGCGGTGGTATCGCGCACCAGAGATCATGTTGAACTGCCTGCACTACACTACAGCCATCGATG
TGTGGGCGGTGGGTTGCATATTTGCGGAAATGCTACTGCGTGAGCCGCTGTTCCCCGGAAACGACTATTTGCACCAGCTTAAGCTTATCATCAAGTTCCT
GGGCACCCCAAAGCAAGAGGACATTGGGTTTGTGAAGAACACTAAGGCGCTGCGCTTCCTCACAAAGCTCGCGATTTCCAAGCCGAAGAAATGGCATGAC
GTGTTTGCTGGCAGCGGCACTGAGAATGCAGTGAGCTCGGAGGCTATCGATCTACTGAGCAAGATGCTGCTCTTCAACCCGGAGAAGCGTATTTCGGTGG
ACACCGCGCTTCGACACCCGTACCTGGCCACTTTCTTCGACGAAAATGACCTCGTGGTGTCGAGTTCGTTCGACTTTTCGTTCGATCTACCAGACGATCA
GCTGTCCAAGGACGCGCTGATCAACTTGCTGTGCGAAGACATCGAGCAGTTCCACCCGCCAGTGCCGACCTCGATCGCACCGCTGCCATTGGGCGCCGCC
GCTAGTCGGTTCTTCCGGATGGGAATGACTGCGTCGGCAAGTTAGTAGTAAAATAATTCAATAGTAACAAAGCATACTTCACCAGATGCATGGCTGCGTG
TTCAGCCTAATTGCCCCGAAATCACTCGGTCTGACACGCGCATTGGTTATTGGTATTCGGACTGGACACTCGCGTGCCTCCACGGGCACTCGCGCTAACA
ACGCCTGTCCTGTGTGACACCGAGTTCGAAAGCGGCTTTCGCCGTCGTTGGCGGCAGATAGCATCGCGTTGTTGTGCGGTTTGCGCTGTTCGATGGTGGC
TCTATGGTCCGTTTTGCATGGTGACGACGGTTTCAATGAAACTTTCCAACGCATCAAACTCGTTCCACGCGTGCGCGATGCCTGTGCGACCAAAGGCGGG
AAGAAGGAGGCAGCGCGCTCTTTTCAAATTCGAGCTGTTACGAGCACGCCACCGCTGGATACCCGCTTTCATTTGGGGCCGGAGCTGCTCACCATGGCCA
CTTCTCGATTTGCTCTCAACCAGGCAAGCATACCGATTCCAAGACCATGAAGTTCTTCGCTCCGATTTTCGCTGCCGCCGCGATGTTCGCCGCTCAAGTG
AGCGCCAACGGCGTCTGCTACGACCCGAATCACGCTTCCTCCGGCACTATGGACGTCGACAGCGTTGGCCAAGACATGGACGCCATCAAAAACCAAGGCT
TCACCATAGTCCGCACATACATTTCCAAGTTCGGCAACGTGAACTTGGGTCAGGCCATCACAGCACACAACATGACAGCAGCGCTGGGCGTGCCGTACCC
AAACTCCGACTGCGTGGACCAGATGGATGCTGCCCTTACGGCCGCCCTCAGTGGTGGCGTGCGCTACATCTTTGTCGGAAACGAAAATCTCGCAGGCGCG
TACGCTGTTCCATACGACATGATCAGCTTCATCAAAAAAATCAGATCGCTCGTACCAGTCACGGTGAAGGTTGGCACGGTGCAGCGCAACACCGAGGTCA
TCAACTACTCTGGCATCGCGGGTTGGTCGGATCTGGTGGATGCTTGCGATGTGCTGGGCGTCAACATCCACCCGTACTTCACCCCGGGGACTACTGCGGA
CAACGCCATCGACGTGCTCGACAATCAGTGGAAGGTCATGGAGGCAAACTTCGCCGACAAGCTGTTGCTGACGGAGACGGGATGGCCCTCGGACGGAGAG
CTTTCGGGCAACACCGGCAGCTCGAAAGGCCAGGAGGCGTTCTTCGGCGACTACAAGTCGTGGAGCAAATCCAAAAGCGAGGCGTTTTACTTCCAAGCAT
TCGACACGCCATACAAGACCAACACGTACGAGAGGTCGTACGGCCTCCTCACATCGGACTCGGTGCCCAAGTTTGGCATTGCCGCCGCGTCCAACTCTGC
AGGAACGGTGACGGCTCAGAACCAGAACCAGAACCAGAGTTAGTGACATATACTGTATGGATGTGTTGTTGCCAACCTTGCTGAGTTTCGACGTGCATCG
AGTACTTGAATCGTTCTGATAGACCACCGACACTACAATACTTAGTAGAATTCACACAAATACATTACACGTTCAAAATTTCATGACATTTTCTTGTCAA
AGAACTCAACGGCCCCGACCGAAGCCGCACGCCATAAGGAACTGCTTCATGTCATCACGAATAGCGTCGCCGGAACGTAGGTTGCACTGGATGCTCGTGT
CCAAGGAGACGATGTGGTGATACCAGAACGACGGCAGATACAGCACTTCGCCGGCCGTGAGCGCCACCTCCGCTGCTGGGCAATTGCGTGCAGTCTCGGG
CAGGGCACTCGTGTCTGACCAGTTGAACGTCGTGTGACGCGCAGACTGGCCCGTGGTCATAAGACCTAGGCACTTGCACGAACTCGGCGGCGAGATCACA
TAGCGCTTGGTTCCACGAATCATGGAGATGTGGTTGAACCCACCGTCAATGTGGCCCTCAGCAATGATACCTCGCATCCCAAGACGGCAGCGCATACCAT
GCTTCTTGGCGATAGAAATATCGCGAATATAAAGGTCGCCGAATCGCGTGTCGTGCCCCGTTTCCACCGCGCTCAGGAATCGGAGATCATCGTAGATGAA
CGCTGCTCGGTTCGAAAAGTCCTTCTTCTTCAGCATGAAGTAGTAGTACTCGTGCGGCTCCCCAAGCTCCTCAGGCAGCTTGACATCATTGACTGCCTTC
ACGAACTGCGGGTATGTCATCCAGCGCGACTCGTACGGGTCCTTCTGGCCTGCGACCTGATTGCTCTTCATATAGTACATGAAGTGGGTATCGTTGGTCA
CATGGACCTTGTAATACGCCGTGGCACTAAGCTTCTCGGTCAAGTACTCGTCCGTCCACAGCTCCGTCGCCGCAGTCAGCTCCGGCACGCCGTACGTCAC
AAACGGCACCTCCATCTCCCGGAACATCTGAGCCAGTCGAAACTCGTACTACAATACCCAAATACCAAAAGTCAATAACTCTTTCCCCATAACGCAACCA
CTTTTTGTCAATAACACTCACCGGGTCAGAAACGTTAAAGTGGCAGATACTATCGTAAAATGCACGAGGCAATTGCGTGTCCTCCGGTTTCCAATTGTCG
AACAGCGCGGCCGACGGGAACAGTTGCGGGTATGCTTTGCAGCCTTCCTCTGCGTTCAGGTCGCACTCGTACCGCAGCGACGGCAGGTCGCACTGGAACT
TGTTTGCGGTGCCGTCCGGGTACTGGAAGGGCAGGGACCGCTGCAGCTTCTGCCCCTTGATGATGACGGCGCTGTCCCCGGCCCCCCAGCGCAGCGGGTT
CTCGCCACCGCCGGCGTGGGACTGCGGCCGGAGGTTCGAGAGCTGCGACGACA