Description :
From Genome Similarity Track
Location :
Scaffold_375:18201- 19786
Transcript NameFunction/comments
g11184.t1XP_009532547.1 hypothetical protein PHYSODRAFT_515318 [Phytophthora sojae

Sequence
1585 bases(100 bases per row)
GATGAGCTGCAGCACTAACGCGTAGCCTAGAAGAATGAGCATGTTGCGAGATACGTTGACGTTTTCCATGCCGTAGCTCTTGAGCAGTTCCCACGCTTCC
TTCGTGTTTTCTTGAGAGAAATGCTCGTACATGAACGACTCGAACGAGTACGTGTGGAAGGCGAGATAGTAGCCCCATTTCCAGTACGCAGGGATTGCGG
AGAACGGCACCATGAAGCCTTCGCAGAGCATGAACATACCGAAGAGACCGGCTCCCAGTGCGATGCCCATGATGTAGTGCGGCACGGCAGCTCCGAGCAG
ATGCATCATCGACTCGGCAGTGACGAGTGACAACGTCAAGTTCAGGAAGAAAGACCCGAACGAATGCACGTGAGCAAAGTACACTACAATGAAGGACGCC
AATACCGAGATAAACGTGATACCGGGCAGTGCACCGAGGAGATTGGCAGTCGTGTAACTTGCGAGGTGCAGCGAATGTGACCGCACTTCTCGTTCCAGCA
CTGCTCGTTGTTCCAAAAGAGCCGGTAAAGCTGCAACGGACATGAACACCAGGAAGGCTTGCACGTAGAAGAGCAGAGGGACCATGGCAGCGCTTGTGAT
TTCCTGGTTCGAGCTCAGGTACATCGTACCGACCATGAACGACAGCAGGATGTACATGAGCACACGCAGCCAGAACACTCCCGGGTGGCGCCAATTGTTG
GTCAGATTCCGTTGCAGCAGCACGCAGAACTGGTCAAGTCTCGAGGGGCGCAAGGCCCGAAGCATCTCGTAGTTGATCAGATTCACGTCCCGCATCGAGC
GATCTCGTGCTACCTCGACACGCAAACGCTGTGGCTCTGACCCTTCCTCGAGAGCTCGAACGAACGGCTCAAGATGCAAACTGGCGTGGAAATCCAGGTT
CACCAAGTGGACGAAGTACTCGGCTGGATTGGAGTACATTGGACACACGTAACCCAAGGAGAAGAAATGTGTGAGCGCTGCTGTTGCTGGACCAAAGTAC
ACCAGTTCGCCGTTGCTTAGGATCACCAGGTTTGTCAGCATTTCGTACACGGAAGACGATGGCTGGTGAATTGTGCATATCACGTTCTTGCCACCCTCCT
GGCAGAGGCGTTCGATGTGCTGCATGACACTACGGGCCGACGAAGCGTCTAGGCCTGAGGTAGGCTCGTCAAGCAGGAGCAACGCCGGATCTGACAGAAG
TTCCACAGCAATTCCCAGTCTCTTGCGCTGCCCAGATGAGATCCCTTTGTGGAAGACATCTCCAACGTTTGCGTTCATGCAAGTCCGTAGCCCCATGGCG
TCGATAACGTCTTGTACGCGTGACTCGCGCGTGAGAGCGGGGACGTGACTTGGCAGCCCAAGGCCTGCCGCGATTTGGAGAGTTTCCAGAACTGAAAACG
ACCCGAGAAATGCCATGTCTTGCGAGACGTAGTTCATGATCGAATGGAAGGTGCGTGGGTTTCGAGGCTGACCGTTCACGTCCACAATGCCCTCGACGCG
TACTCCGGGGCCTCCTGGCGGCACTCGATCTGCGAGGATGTCCAACAGCGTAGTTTTGCCGGCTCCGGACGGACCGATGATAGCT