Description :
From Genome Similarity Track
Location :
Scaffold_483:1820- 4509
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_483-snap-gene-0.53-hydroxy-3-methylglutaryl-coenzyme A reductase

Sequence
2689 bases(100 bases per row)
CAAATACTACCAGCGCGTCACAGCCGTCCGTGTGGTCGGGCTTCTACAACAAGACGCTACGGGAGCGCATGGACGTGCTATCGCTCATGTACCCGCGACT
GCAGCGCGTGCGACAGGACGCTGCGGAAGCCGCGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNACAAGCCGTTTCTGCCGGACGCCACCGGACGCCTCGG
CGAGCTGCCAGTGCGCTCGGCCAATTTGATGATTGAGAACTGCATCGGCGTGCTGGGCATTCCGCTCGGCCTCGGCCTCAACTTCGTGGTCGACGGCAAG
CACGTATCGGTGCCCATGGCCGTGGAGGAGCCGTCGGTCGTGGCAGCCGCGTCCAGCGCCGCCAAGCTGGTCGCGGCCTTTGGCAACGGCTTTGCGACCT
CGACCACGGGCAACATCATGACGTCGCAGGTGCAGCTTGTCGATACGCCCGACATCCCGTACGCCATCGCGGCGATTGCCCTGCACCGCGAGCGGCTGCT
GCACATGGCCAACACGACGCTTTGCCCCAACATGAAGAAACGCGGCGGCGGCGCCGTCGACGTCTATTGCCGCATCGTCACGCAGCGCGCGCGGTCCCAG
CACACACACAAGACGAGCGACACGTTCTGGTACACGCCCTGTGACGACGAGCTCGCGATTGATGCCTCGGCTTCGGACGTCGAGTACCTCGTGGTCCATA
TTGACGTCGACGTGTGCGAAGCCATGGGCGCCAACATCGTGAACACGGTCGCCGAGGGCCTTTCGACCGAGATTTGCCAGCTCACCAAGAGCCGCTGCGG
CCTGCGCATCCTCACGAACCTCTGCATGCAGCGCCGGACGCGGTCGGTGTTTGAGATTCCGGTACAGAAGCTCGGCTGGAAGGGCGTGGACGGCGAACAG
GTCGCCCTGCGGATCGTCGAGGCGTACAACTTTGCTGCCATTGACCCGTACCGCGCCGTGACCAATAACAAGGGCATTATGAACGGCATTGATGCCGTCG
CACTTGCCACGGGACAGGACTGGCGCGCCATCGAGGCGGCCGCGCACTGCTACGCGAGCCGCTCGGGCCAGTACGCGTCGCTCTCCAAGTACGAGATTGT
GGACCGCCCCAGCGACGGCGTCAAGGTGCTACGTGGCAGCTTGGAGATGCCCATCTCGGTCGGGTCCAAGGGTGGGGCACTGTTGACCCACCCAGGATAC
CGCGCCACCCACTCGATCCTGGGCCAGCCTGACGCCAAGGGACTCGCGAGCCTCACCGTGAGCGTCGGTCTCGCGCAGAACTTTGCCGCCATCCGCGCGA
TCGCCATCACGGGCATCCAGAAGGGCCACATGGCCTTACACGCTCGCAATATCGCGGTCGCTGCCGGTGCGCCCAGTGAACTCGTGTCGGAGGTGTGTAC
CTACATGCTGGGCCGCAAGTCGATCAACATTGAGACGGCACAGGAGTATCTCCACGCGCACGAAGTGTTTTCCGAGATCCACCACAGCAGCTCGCCGCCA
CTGTCGCCGCAGTCGTCCACGCCTCAGGCCGAGCCGCCGCTGCCGTCCATGTTTTACGTCGAGATCCCCGTGCCGCATCTAGAAGGCACCATCAGTCTTA
ACATTGCCTTCCAGTCGCTCAACAAGCACCCGCAGTACATTGCGATCCAGCCGACGTCTGCCAAGTCGGACGCAGCGACTTTGCCGCTCATCCACCGGCA
ACTGCTGGGTGACAAGGGGTACAACCAACTCGAAAAGATGTTTTTGTTCTTGGCGTCCATGCGGTCCATTGTGATCGCCGACATTGGCGACCAAGACGAC
TCGACGCCGATTCTCTCGCGGGCCAATATCGCGCTCCAGAACAAGCTGCAGTTGCTCTCGGTCGTCATCAACATCCTCGTGTCTCGACTACTGGAAGTGC
GGTCCCACGTGGCCGGTGCGTTCATGCGCGACGTGCTCGCGAGCGGCGCGTCGTTGATCGACTGGGACGGCGCCAAGTGCCACGCGCTCTTGCAGGACGT
GCCCGCGAGCGACGACGTGCTGTCGACCGGCCTGCCGCTCTTTCTCGCGCTCTGCCAAGTGCTCAAGTACCACTTGGAGCAGGACGTCGCGCACGCGCTC
ATCCGCGAACGCATGGCCACGGAGCAGTGGGAATTACTGCGCGCCGTGGTTGACAACTTTGCATTGCTGGCTGACGGCGTGCCCACACGTCAACTGGAAG
CTGCCAACGACCAGGAGCTGCTCGAGGCGTACATGGTGACCCACGCCAAGCGCTGGCAGGCGACCATGCTGCTACTTGTGGACGCACTGGCACTGGCGAC
CGAGCACGTGACGCCCGCGCGGCTCGACACGCTGCGTTGCATCGGTGAGTACATGGAGTGCGAAGGCACGATCGCCCACGATCTCGCACGCTACCGGCGC
GCCGTGACCGAGCGCCTCCCCAATGCGTTTGTGCACTGGATGCGATGCCACGGCCACGCCGTAGACGACGAAGACGCCGACGAGTCGCTCGTCGCAGCGT
TCCGAGAGGCCACGGACGCATACGCCGCGCGCAAGTGGCGTTGCATCGAACAGGCGATGGCAGCGAGCGAGGCGCCGGCCGTGTTTTCCCTTGCGGCCGT
CAAGCGCGTCGCGCAGCTCGTGTGGGACGTGTACGCTGCCCGCAGCGGCAAGTCGCCTCGGAAAGACTCGTTCTAGTTTTGAGGGGATT