Description :
From Genome Similarity Track
Location :
Scaffold_1113:182- 2044
Sequence
1862 bases(100 bases per row)
GCTCGGTCTTCGTCTTGATCCGTGGCCGTGAACTCCTTCAGAACCGATATGGCTGAGATCCGTACCCTCTGGGTCATGGACGATCCACTCGTCCCGGCTG
CAGCTGTTGCTACCGCCGCTGGTGAAGGGGATGGGCCATCCAGATCATCTGGGTCGAACTCATGGAGGGAGTTGCCTCCCTCCACTGACTCCATTTCAAC
GTCTCGTGATCCATGTTCGTGGAACACTTGCGCTTGCGGCCCGGGCGCTCTTATGCCCTGTTCGGCCAGGCAACGACTCATCGCAGCTTCGAAGTGTCGG
TGCAGGGTGTCCGAGGAGGGGCGGAAGAGCCTGTAGCCGGCTGGTCCACTGGCGAGACCGGATCCGTGAGGCGATTACCTTGAACCCGATCTGACGATAA
CCCTACTGGCTTCTTGCTGGATCTGGCTCGATCCTGGTTGGATTGTATCAGATCCCGGGTAGGGCGTACTGGATCCCAAGTCTTCACACTCGAGGGCGCT
TCTTGTCCCCGGACCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCCAAAATCATGCGTCAGGGCTCGGACGACGTGTCTGACCCATCCTCAG
CCGCGTATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCGTAGTGTGCGACCTTTCTCCGGTGATGAACTTAACGCTGAC
GAAGAGGTCCTGCGTCGCGGATACTATGAGATCCAAGTCTAGCTCGAAGATATCTTCTGCGTCGAACACACCAGCTACGATGCCGGAATCCGTAAGCAAA
CGTAATAGATCTTTGACTGCCACCAACTGGTTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGAGCGTCGATCTGTCGTGGATTCAGGATCTGC
ATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTT
CTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGT
TGGCTTAACCGGTGAATCTGCAAATGGATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGGGCTTGACTTGCGTCAAGATCCGCAGGGGTCCCC
GAGGGGACCTGGGGGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCACCTCTCTTCCGTCGATAGTGTTCCTCCCAGGACTCCATCGATCCGCGGATCT
TGCTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGATGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAAT
TCCCAGTCACCTAAAGATCCGGGCACGCGCATCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCTGGATCCAACTTAGCAGCAGCGCCCAGA
CACCGACTAACGGAGGGGTCCCCCGATGATCCGTGATCTGCTGAACTTTTCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACT
TCCGAAACGTTCAAGTGGCGAAGCTTGCGTGTCTTGGTGAGACGTGGGGATGGGGGGGGCAGTAGTGGTAAGATCTTCACTCTGCGTCCGTGGTTGGTTC
TGGATCCTAAGCGAATATTCGAGCTTAAGTGGATCCAGGGCCTAGATCGTGGATCTGTCCGTAGGGTTGCATTGCGGGTGTGTTCCCTTGCATTTGCGTT
TCTTTTGCGTTTCTTTTGCGTCGTACTTGCCGCCTCCTGTGACGAGATCTTGAGAGTTGAGA