Description :
From Genome Similarity Track
Location :
Scaffold_2521:182- 1928
Transcript NameFunction/comments
Phyta_totarag14576hypothetical protein PHYSODRAFT_332751

Sequence
1746 bases(100 bases per row)
ctCGCGACCGAGACACCGAGACCACAGTATTGGATCTGGAAGCTACGGAGTAGATCGCTCCATTTATTTCGCGTAGTTCGGCTCAACTGGCGGTACCAAT
TCCTCACAGGCCCCGTCAGCAGATCTCCGAATGTCAGACACTTTTCTTCGTCGGAGGCTTGATCACGCAGGAATGCGGACTTAACCTTGCTGATCCACCC
TCTGGCccgatcttcatcttgatcttTCCCGGTGAACTCCTTCAGATCCAAGATTGCTGAGATCCGCACACGTTGGGTGAGCGCGGATCCAGCCGTCGTT
GTGACCACTGCGGCACGAGTTGGTGGAGCATCCAGATCGTCGGGGTCGTACTCCCAAAGAGTGGGGTGATGATCGGGCGATCCGACCAACTCCATGTCCA
CATCTTGCGCGCCAACGTTCCTTGTAGTGGTCGCGACCGGGGTTGGTGCCACGACTTGCTGTTCCTTGAGGAATCGGCTCATAGCAGCTTGGAAGTACGA
TTCCAGCCTGCCTGTTGATTCTTCCGACGAGGTTATATTCGTGATCTGGTTTGGCTGTCTCTGCGGCGGCCTCTGCTGTCGTGGCAGTGTCCGATCCGAG
AACTTCCTACGAGATGGATATCTCAATAGTGCTTCTCCGGAAGGTCCGAGAGGCATGCGTTGCGGCCTTATGGATCCACCAGAGTCCGGTTCTGATGTAG
CTGATGCATAATGTGAAGAGCCAGTCTGGCACTCCGTCGTGCTGATTTGGGGCGAGATCGCTGGATCTTCGATCCGTGTATTTCCGCCTACCAGGATCGC
TAATCTAGCGAAAAGCTCTCGGGAAGTAGATTTGACGGTGTCTAGGTCGAGATCAAACAGTCCGTCAGCGTCGAAAGCACCGGCCACTAGACCTTCCTCT
TTCAACGTCTGGAGTAGGTTCTTGACCATGGTCAGCTTGTTGGACGTTTCTGGCGGAGCTGATACTGGTCCTTTCAGATCTCCGATCTGTTGTACcttca
tgatcttcatcACCGGATCTTGGAGTAAGAAGTTGCGAAGCGCTTTGTGGTGAAACGCGAACTCTAGTTCCGGTTCGGTCCATGCAGATGGAGATTCTTT
CTGATCTTCGCCTTCTGACTCAAGtgccttcattttcttccccgtagtcttcgttttcttcttcttcgtatTAGATCTTGCGACTAGCGGGCTTGCGGTC
ACTTCATCCGTCATGAACGCATACGGTTCGGGTTTAACCTTActgattttgttttgcggATCTAGATGCATATCGAGATCCCCTGGGGTCCCCAAAGGAA
CCTGGGGAGGAGGTTGAGGTTTCTCTTCTAGATCTGTTTCCAGATCTCCCTCATTCTGTCCACAGCGCTCCTCCCAGCACTCTGCCGGTCTGCGGATCTT
GCTTCATTCAGCGGCGTCGTAGTCGGTTCGATCTCCGATGACGCTTGATTCCCTTGTTctttcttcaccttcacaACTTCTTGGGACTCACGGTGAAATC
CCGAGTCACCAAAAGCTCCCGGCACGCGCACTattgtggtgtagcgggatccgTCAAAATCTTAGTAAGACTGAATCCGGCTTCCCAACTTTacccagac
accgactaacggaggggttccccgatgatccgtgatctgTTGAACTGGCCACCTTGTGTATCtgtcggtgggctggatctgctctctTGGTAACTCCGAG
GAGTCCAATacgtgaagaacttgaaCGTCGTGGCGAGACNGGTTAG