Description :
From Genome Similarity Track
Location :
Scaffold_16:181930- 185579
Sequence
3649 bases(100 bases per row)
GCCCTCCCTGTCTGCTCTCCTGGAGCTGGACGAGATGTCCTTGGCCGAGTTCGGCGAAGCCTTGAAGGCTGGAGACTTGGCTGAGGTAGTGGTCATACGA
CCCGAAGAAGAGTTGAACTCGTCCTCGCTTCTGGATGAAGCTGTCCTGGAAGACACCAAGACGGCGCTGAATGCGCGGAGCGGATCGGCGATCCTGAAGG
ACCCGTCGGATCCCTTGCATCAAGTGGTAAATGATTACCAGGACGTGGATTCGAAGGAGCCGCCCTCGGGGCTACCTCCGGATCGAGGTGTTCGACACGA
AATCGATCTCGTTCCGGGAACGAAGTACTGCGTGACGAGGCTGTGGCCCTTGCCGAAGGAGCCGTGTGACGTCATTGACGCGTTCTTCCGTGCGAAGCAC
GAGGCGGGCATGGTGCGTGAGAGTAAGTCTCCACACTCTACGCCGACATTCTGTGTCAGAAAGCCGAATGGCAAGTGGCGTATCGTGCATGCTTTCAACA
AGCTGACTGCCGCTACCATTCCGGCGCAGACGCCGATTCCTCGGAAGGATGTTCTTCAGAACAACATGACAGGATGTACGATGTACAGTGCGCTCGACTT
GGTCGATGGATATTACCAATTGCTCATGAGGACGAGCGACATTCCTGTCACTGCGGTGAGTACTCCGAGCGGCATGCTCTGGGAGTGGTTGGTGATACCC
CAAGGGCTTTCGAACGCGCCAGCGACGTTTATTCGTCTTGTGACGCAGCTCTTCAGGCCCCATCGGGCGTACGCGCAAACGTACTTCGATAACATCTTTG
TCCACAGTCGTGCGGAGCACGAAAAGACTGATATGGAGAACCATGTGGAGCACCTGCGTGCTGTGCTCGAATGCATGCGTCAATACAAGTTGTACGCCAA
CATTGACAAATGCATCTTCGGAGCGGAAGACATCCTTTTCTTAGGGTGCTTCATCGGGAAGCGTGGCCTGAGGGCCGACCCGGTCAAGGTCAAGGCCATT
GTTGACTGGCCGGTTCCCAAGAACCAGAAGGATCTTCGCAAGTGGCTTGGCTTGGCCAATTACTTGCACAAGTACAGCGATAACTACGCTGAGATGGCTC
GGCCACTCTCCAACCTCCTAAAGAAGGATGCGGAGTGGTGTTGAAACACCGAGCATCAAGATGCGTTCGCGGTCATTAAGGACAGTCTCCTTCATGCGCC
TATTCTGGCTCTGCCAGACCACGCTCGTCCGTTTAGTGTCGTCTGTGACGCCTCGAACTTTGCCATCGGCTGTGCACTGCTGCAAGCAGACGCCGAGGGA
CGCGAGCGCGTGGTGGCGTTCGAATTTCGCCAGCAGAAGGCTGCGGAGAAGAACTATCCTGTCCATGACAAAGAGCTACTTGCGATGAAGTATGCGCTCG
TCAAGTTCAGGGTGCACCTGTTGGGCTCTCAGCCGTTCGTGATTTACACGGATCATGCATCGTTACGCACTGCGACTCAGTCGCCTCACCTCTCGCAAAG
GATGGCCCATTGGCTGTCCTTCTTCGCGGAGTACAACTTCGAGGTGAAGTACAAGCCTGGCAGGCAGAATGTCCTTGCGGACGCGCTGTCGCGCAGGCCG
GATTATGAGCTGGCTCATGTAACGACCGTGACTTCGTCATTTTTTCGGATTTGATCCGAACGGCTTATGCCAAGGACGACACCTGTGTCGCATTGCTGAA
GGCTCTGGGGAGCTAGGAGTTTCAAGACTCGGACATAGAATTGTCAGCGCGGCTGCGCGCGCGGCTACACCGCTATTCCCTCGATGGTGGCCTGTTGTTC
TACAACACTGACCCCGAGGATACGCCCCGCGTGGTCATCCCTCATGATGAGGATCTGAAGTATCGCATCCTCTATGAGGCACACGACACGTCGCTGGCAG
GCCATCTTGGCCGTGAGAAGACCTACAGCTCGGTGAGCACCCACTACTGGTGGCCGAAGATGTACAAGTGGACGAGCACTTATGTGCGCACGTGCGAGAC
GTGTCAGCGCGTGAAGTCGTCACCTCATACTGCAGCGCCGTTGGCGAGCTTGCCTGTCCTTTCGGGCTGTTGACAATCCATGAGTATGGACTTTGTGTTT
GGCCTGCCGGCGGACGCGGCGGGCAACACTGGAGTCGTGGTCTTCGTGGACCGACTGAGCAAGATGGCTCACATTGCGGCTGTGCCGGATACCATCGATG
GTAAAGGTACAGCAACGCTGTTCTTGGACCGAGTGTTTCGACAACACGGACTCCCTGAGTCGATTGTCTCGGACCGAGACCCCGCTTCACGGGCAACTTC
TGGAGCGCGGTCTTTGCGGTGCTTGGCACCAAGCTGGACATGTCCACGGCGGACCATCCGCAGACCGATGGTCAGACACAGCACGTGAATCGCGTCGTCG
AGGACGTGCTCCGCAGCATTTGCGCCGAGACGCCGAAGCGCTGGAGCGCCATGCTGCCACTCGTTGAGTTTGCGTTGAACAACGCCGTGCACGCCTCGAC
AGGCTACACGCTGTTCTACGTGAACAGCTTATCTCATCCCCGCGTCTCGCTGACGCCGCCACGTGGTGGCCTCGGGCTTGGTGGGGGAGGAGAAGCCGAT
TTAGCTGATCGGTTAGCCGATGTCAGCCCGACTACTGTTCGTAAACAGGTTGACGCTTTCTTGTCGACGCGTCCGAGTGTCTTACGACATGTGCGTGACG
CAATGGCTGAGAGCCAAGACAAGCAAAAGGAACATGCAGATGCCAGGGGCAGAGGCAATGTTGCAAGTTATGAGGTCGGGGACCTGGTGCTGCTTAATGT
AAGAACCTACCTACACATGCAGTGTCTGCCGTCTTCAAGACGAAGTTGCGCCCGCGCTTCATCGGACCTTTCAAGGTTGTGGCCAAGAAGGGCCTTGCGT
ACACACTCAATCTTCCGAAGAAGATGCGGACGCACCCCGTCTTCTACGTGGGCTTGCTCAAGCCGTACCAAAACCCGATGCAGGTGCAGATGGAGGCACC
GAGGGTGACGAGGTCACAGGCGCGGAGGTCGCGGTCGTCGAGGACGCAGTCGCAGGCGTCGAGGACGCGACCATCCACGCAGGCACCGCAGGCACAGGCG
GAAGAATCGGCGCCGGAGGTGCCGCGGGCACAGCGAGAGCCGCAGGCGCAGGAGGCGCGGCAGTCGGAGCCTGCATGCGGGCCAGGAGGTGGAGCTGACC
CAGAAGCACAGCCTGCTGACGCTGTAGCTCCCCGAGCTCCCGGCCACGTTGCTCATCGCGATCGCGATAGTATCGCACCTAGTCCTCCAGGGCCCCAAGG
CGGTCCCAGACCGCTCGAGGCACCTCGATCCATCGCGTCCGCTCGGCGAGCTCGTCGAGTTCGGTGGCAGTCCGGCCCAGACGCGCATCAACGTCATGGA
TATGATAGAAGGCGACCCGCCTGCTGCCACACCTCCAAGAGCTCACTTTGAGTCGCAAAGGGCCCCACAGCGGCCTCCACCGGCCCTGCTCGATGAGCAT
GGGAATCTACATTACCATGTGGTGCGCCTCCTGGCGAAGCGGCGGTGCCAGGGTCAAAACCAGCATCTGGTGAAATGGCGAGGGTACCCTCACTCCGAGA
ACTCATGGGAGTTTGAGGTGCCCCTCCGCCAAGACTGCCCAGACGTCGT