Description :
From Genome Similarity Track
Location :
Scaffold_6:181885- 185462
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G003013Similar to VTG2: Vitellogenin-2 (Gallus gallus)

Sequence
3577 bases(100 bases per row)
CAGCGTGTCCAGAACGTACCACAGCCACTGGTCCACGAGCAAGATGTTGAGCGTGTTGGCCTCGCCATTGAGTCGGCGGAACCGCGACTTCCACGCTTCC
GACGTGATTTCGTACTTGTCTTCGGCTTCTTCTTCCTGCTTCTTCAACACTTTCTCTCCATACTCATCGTATATGGCCTTGTGAAACCGGCGCCAATCTA
AATGCGCTTCGAGACCGTCCATCGCAAACAGATCGGCATTCGCGTGCACTTGGAACTCGGCGAGGTTCTGGATGTCCTCCATGTACGAATCGGCCCAGAG
CTGATAGAGCTCGACGCCGAAGCTCGGGAGCCGGAAGCAGAGCACCGAGAGCATGCGTGCGACAAAGAACATCAAATTGTTGTTCATCACGCCACGCACC
GAGACCGTCTGCAACACGCAAAACTTGGTTTCGACGAGCATCGCGCGCAGCTTGAGACCAAACTCCAGGTCTCTCTTGTTCACTTTGTGCGACTGCTTGA
ACATTGCCGCGTTCGTGACGACGCTCGAATCGAAGCCCAACAACGGCAGATCACTCAACTCGGCACGCTTCACGAGGTAAAACAGCAACTCGTAAAACAC
GTTCCGCAGCGTGTAGTGGCGCACGCGGATGTTTTCCAGCAGGAATTGCCAGAGCCGCAGCAGGATGCTCTTGGTCTCATCGAGCGCTTCCGTCGACGCG
TACACCCACGAGAGCATCGACGCCTTGTGCGAGATCTGCAGCATCTTGAGGATCTTGGTGGCCTTGCGTACTTTGCCCTCTTTGTCGTCTTTCTGACGCA
CCGACATGAGTTCCACGAGATCCTGCATCTTTTCCAGCACGCGCTGCGCCTCGATCGGGATCACGACCTTGGACTTGCGCGCCGGTTTCTTGGACGTCGG
CACGCCGACGATCACGGAGCTCGACGACGAGATCCCGTTCTCGCTGATCACGCCGCAGCGCAGTTGCCGCACATCGGGGATCTTCTTGAACAAGATCGTG
CCGTATACGACGGCGACCTGGTGGCCCTTGAGCGTTAAACTCTGTTCAAATTTGCTCGTCACAAACTGCTCCGAGAACCCGAGTCCGTTGAGGCCGAGCG
TCGGGTCGGCGTCGAATTTCTTCTTTATCCGCTCCTGAAGCGCGTCTTCAAAGATCTTTTCGAGCGACAGCCACGTCTGCCCAAAGAGCAGCGTGTTCCG
GATCTCCTCTTCAAAGCGCGGGTCCTGACTCGCGACGACCGCGGTCTCTCGGTTGTACTTGTCCAGGAGTGTGAGAAAGCCGCCGTCGGGGTCCGTCGCA
ATCTGGCCACGTCCGACGCACAGTTGACGAATCTAACAACAAAAAATCACACACACACATAAAAAGCAGAGCGTGAGGACGCGAAAATGACACGCAACGT
AGCAATTGTTATGCACAGCGTACCTCGAGCGTTAATGTGGCTGACATGAGCTCGTCGAACGTGCTGTATCTTGTGATCGCGGGCAAGTGATCCGTGGCCG
TGGACCACTGGACACCGACGGGATCTTCGGCGACGAGCGGGTCCGCGAAATCGTCGTCGCTGGCGGCCGCAGCACTCGAGAGTTGCTGCGAGTTCGGTCG
CGAGACGCGCGACGAGAGCACGGCGAGCCGCGCGAGCGACTGGAAGCTTACGTCGTTGATCTCGGCCATCACGCGCTTCTCGGCGTGCTTGAGGTTGTTG
CCCATGTAGAACGCCTCGCTTGTGCCAATCGTGCACTTGTAGCTCACGGCAAACTTCTTGAGCGGGAGCGACGCGTCTTCCTGGAAGTCGTGGCCCTCGG
GCCGGTCGAGTTCGTTCGCGATTGCGGGCATCATCACGCCGACGTCGCTCACCGAGATGTTCCATTCGCTGCACTGCTCCATGTAGCAATTAAACACAAT
GCGGCCATTGTCGCACCCGATCAAGTGATGATCATGGTGCACGGGGCCCGTGGCGACGCTCCACAAGTCCACCTGTGCGCACCCAATCATGGTCTTGGCG
TGGAACTTACGGTGCGTGAACACCTTGGCCACGAGCAGCTTCTTGGGCAGCAGACTGAGTGTGGCCTTGTACTCGAACGCGATCAGCAGGCCCTTGTAGT
TGGGGTTCAAATCCGCCTTGATCACGGGGGTAGCGTATGGTGCTTTCTCGTCCGGGTCGTCCCAGTAAAACTCGACGAACGGGTCTGACTTGCCACTGAA
CTTGCGGCCCTGCAGGTTGCGGCACTGGATGCCCGAGATGCGCACGCGAAAGAGGCATTCGGCGTCCGCCGCCGCGGCGCTCGGTTCGAACATCGAGCGC
AGGAAGCGCGGACTCGCACGCTTGCTCGGCGAGCCGCCCGCGCGGTTCAGGCTCACGCCATACTGGTCTCCGAACTCGCGCGTGGCTTGCGAGAGTTGGT
TCCACGAGTCTGCATTCAGCGACCGCGGCGACACGGGCGCGCTCATGCTAAAAGAGGGTCGCGTTGCGGCAAAACCCCCGCTAGATCGGGGTGGGCTTGC
TGCAAAAGCGCACGTGCTGGTCGGCAACGATCGCAGTTGCTTCTCTTGTCGAGTGCAGGGATTTCTTGCAGATACGTTTGGTGTACTTCAAGTCGGATTT
TGTATGGGAGGGCCCGATCGATCGCACACCTGTTTGTCGCCAAAAGATCTCGTGTGGTGGCGCGCTCGACACGTTTTGCTTGTTGTCGAAGTTGCTGGTT
TGCTGGTTGGTTTGTTTTTCTCGTAGCTAACGCACGCGCGCGTCGGTTCCGTCTCTCTCTCTTGAGTTGCTTTGCGACTTGCTGTGTGTTGTTGTTGTGG
CTCGCGAGTCGCTCACAAAGGGGGGGACTCGGCCTGTTTGTTTGCTCCTTTTGGGCTTGCTCGCTGGCGAGAGTGTTGGTTTTTGTTCCTTCTTTTGCTC
TCGTGTGGGGGCGTTTTGAACTGAAGTTATAACAGAGAGGACAGAAGTTGCATAAACAACCAGCCGACACAACAACACCATTACGCAATTCAACACACAA
AATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN