Description :
From Genome Similarity Track
Location :
Scaffold_118:18188- 20121
Transcript NameFunction/comments
Phypl_g3529translocation protein SEC63

Sequence
1933 bases(100 bases per row)
TCGCACTCTATTTGTCCTTCTTGCTTTCCTCGGCCTCCTTttcggcctcctcctgctcctgctccaggtcctcgtcctcttcctcgctaTCACTCGAGTC
CGCGGCATTCATCACCTGCTCGAACAGCGTGGGTTCGTTATCTAACTCCAAATCCTCCGGGTGTGGCTTGTAGACCGGCAGTGTGGCTGCGGGGGCGACG
TTGAACTGCACAAGACAAAAAGGAAACCACTGTTAGAAATCTTCTCCTGGTCAGGGGACAAGTCAACACGCCACTGCTATAGCCTCGAATACGAACCTTA
GCAACAGCGCGCAGGTCCATGCCGACGTATGCGTCGCTCTTGACGAAAATGTCCAACTGGTAGGTGCCGGCCTTGggcggcgcctgcagctgcaccttcT
GTTCAACCACACGCTCCTGCGAGGTCATCTTGGCGAAAGAGTGCAGGTGGTTCATCTTCGTGTCGCCCACCACGCAGTACCAGCGCTCCATCTTCGGGTA
CGGGAAACGCGGGGCGTACACGAGGTCGCACGTGTCGCCCTCCTTCACGTTCTTACGGGTAAGCTTCACAGTGACCGTCATAATGTCACCCTCCGCAATA
AATTCCTCATCCTCCACCCCAATCGagatctgcagctccatgtGAGGCATCATGTCCAGGACGGTGGTCACCTCCTGGCGGTCCTCCTCCGAGAGTCCGC
TCAGACCCTTGCGCTCCTCGGGCTTCATGGCGATGTACTGGTGCATGCTGCGCACGGCGTTCTTGCCCGTGACGATGTGCTTGACCTCCGCCTCCGTCAg
gtgcggcagctgcaggaacgGCGGGTCCTTGAACCAGAGTCCCTGCgtcaggaactgctgcatctcCATGAGGTTGAGCGTGGTCTGCAGCCACGACTTC
ATGACCGAGATCTCGAGCATGCCGTCCACCAGCTGgatcgccttcttgagcatcGCGTGGAGGTCGCCCTGCAGCGTGGGGCtcagcttctcgcgcagga
agtgcgcgtgcagcagcaggttggcCTTGGCAATGGCGGGGTGGTTGAACTTGGGCTTGGCCATCATGTCCGACTGCTTGAACTTCTTGAAGAGGCCGCC
gagctccgcgtcgtcggTCGAGCGACGCGGGATCTCACGGAACTCGGCCGAGCCGGCCAGGATCTCGGGCAGCATGCGCGGGTGCGAGTGCTGGGACATG
GCGAAGTTGTAGAAGCCGTACGTGTCGTACATGATCATGCTGTCTCCGTACTTCTTCGAGTGCGAGTACCAGAGCGCGACGCAGCTCGGGATGGCCACCA
CGAGGATGATCAGGTacaggaagagcacgaggtTGTGGTTGGCCGGGTCCAGGAGGAAGGTGGGCAGGCCGAtggacagctgcagcgcctggcggCCGTC
CGGGTTGCCGAACTTCTCGTagttggccttggccacctcATCCGTCAGGGCCTCGTaggccttggccacgagcatAAACTTCTGCtccgcgacggcgtcg
ccctgGTTCTTGTCCGGGTGGTAGAGCAGACTCATCTTGCGGTAGGCGCGCTtgatctcgcgctcgctcacGCCGGCGGCGATGCCGAGGATGGCGAACG
GGTCGAACGACTTGATCTCCGAGTCGTCCTTGAGGAGCAGCGCCATGCGCACGAGCGCGTACCAGAcgccgaccagcaccagcaggttGAACACGAAAGG
CAGCGAGAACACATTGCGGAAGGCCGtcttctcggcctgcagctgcttgagcttgcgcagctcgcggtcgCAGCGCACGTGGCTCTTGTCGATGAGCCGG
TCCTTGAGGAACACGCCGTAGAGGATGCGGCGCAGCGACAGGAACGTCACGGGCACCGCGTACAGCGCGCACAGCGACACGGAGAAGTAGTAGAAGGCCG
AGTTGTCGTACTCCAGCATGGTGGCGGCGGGGG