Description :
From Genome Similarity Track
Location :
Scaffold_17:181871- 183453
Sequence
1582 bases(100 bases per row)
GTCCGGCCTGCGCGACAGCGCATCGGCCACTACATTAAGCCGCCCCGGCTTGTACTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCC
ATTCTCTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAACGACGCATGATCAGTAAAGATCACAAAAGGCTTAGAGCCTAGCAGGTGTACCCTGAATT
TGACTAGAGCATACTTCATTGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTCTCTGCAGCTTTGAGCTGGCGAGACTCAAACGCGATCACGCGTTC
ACGCCCTTTGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAATCGGAGGCGTCACAGACGACGCTAAACGGACTATCCGGGTCCGGTAGCGCAAGG
ATCGGAGCCTGGAGGAGGCTCTCCTTCACAGCCTCAAAGGCTCCGTCGTGCTCGACGTTCCAGCACCATGGTGCGCCCTTCTTAAGGAGATCTGATAATG
GCCGAGCCATCTCCGCGTAGATTGCACTGTACTTGTGCAAGTAATTGGCTAAGCCTAGCCACTTGCGTAAGTCATTTTGGTTCTTGGGAACCGGCCAGTC
CACGATGGCCTTGACTTTGGCAGGATCTGCCCGTAAGCCACGCTTCCCAATAAAGCACCCGAGGAAAGGTATCTCCTCCGCGCCAAAGACGCACTTGTCC
AAGTTGGCATACAACTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAGTGGTCAATGTGGTTATCCACGTCTGACTTTCCGTGCTCGGCACGACTAT
GGACGAATATATCGTCAAAGTACGTTTGAGCGTACGCCCGGTGGGGCCTAAACAACTGCGTCACAAGACGATTGAACGTTGCTGGTGCGTTCGACAGCCC
CTGGGGCATCACCAACCACTCCCAGAGCATACCGCTCGGAGTACTCACCGCTGTCAGCGGAATGTCGCTCGCTCTCATGAGCAATTGGTAGTAGCCATCG
ACCAAGTCGAGCGCGCTGTACAACGTACAGCCTACCATGTTGCTCTGCAGAACATCCTTGCGAGGAATCGGCGTTTGCGCCGGGATAGTGGCCGCATTCA
GCTTGTTAAAAGCATGAACAATGCGCCACTTGCCGTTCGGCTTTCTGACACAGAACGTGGGTGTCGAGTGCGGAGACTTACTCTCACGCACCATCCCTGC
CTCGTGCTTCGCACGGAAGAATGCGTCAATGACGTCACACTGCTCTCTCGGCAAAGGCCATTGCCTTGTTACGCAGTATTTGGTTCCAGGAACCAGGTCA
ATCTCATGACACACGCCTCGATCCGGAGGCAGGCCCGTCGGTGGGTCTTTTGAGACAACGTCTCCATACTCCTTCACCACCGCGTAGAAGGGATCCGAAG
GATCTTTGAGGATCGCCGATCCACTTCTTGCGCTCAGCGCCTTCTTGGTGTCCTCTAGGACCGCGTCGTCCACGACGGATGAGGAGTTCAACTCCTCCTC
AGGTCCCAGCAAGACCACCTCGGCTAGCTCGCCTGCCTTTAAGGCTTCGCCGAACTCGGCAATGGACATCTCGTCCAGCTCT