Description :
From Genome Similarity Track
Location :
Scaffold_4:181803- 218594
Transcript NameFunction/comments
Phyke_g448hypothetical protein PHYSODRAFT_473667
Phyke_g449conserved hypothetical protein
Phyke_g450hypothetical protein
Phyke_g451eukaryotic initiation factor 4E, putative
Phyke_g452hypothetical protein
Phyke_g453eukaryotic translation initiation factor 6
Phyke_g454hypothetical protein PHYSODRAFT_537381
Phyke_g455hypothetical protein PHYSODRAFT_552409
Phyke_g456hypothetical protein
Phyke_g457tripeptidyl-peptidase, putative
Phyke_g458FAD-dependent oxidoreductase domain-containing protein, putative
Phyke_g459conserved hypothetical protein
Phyke_g460hypothetical protein PHYSODRAFT_445341

Sequence
36791 bases(100 bases per row)
CACATAAGCATGTGTCTTCTTGAATACGCTATCAGCAATGCCATTCCAGTGCACACCAGTGTCCAACAAAAATTAGTTAGGCGCGTCTTGGTGGCAGACG
TTTGGGGTTATTAAAGTACACCTGGTGAAAAGTTTTCTCTGCTCCTGGTAATTGGCTTTCTGCTTTTCCAAGATGACAGCCACCTCAGCGTTGGATAAGC
AAGCATCATCGCTAAAATCATCACCTAAATTCAATTCCGCAGCATCCTTCGACTCCATTAGCGGTCTCGGAAAGAACGACATTTCTCACTCTCGCGCTAG
TTGGTTCCTTTTCTCGCCAGTTGGCATTTGCACCGTCCCAAGTGATACTACGTTGGAGAGAACACTTCACTAGTACGATATTGCTGCCGTCACCACGACT
GCTTTGCTATTAAACAAGCAGCTACTCGGAAAATTGTCGACTGCCTAATACTGGTTGTTGAAAAAGCCTTGGTAGCTCCAGCTCACACGGGACCGGTTGC
CCTGCTGCACGTAGTACTTGTTTCAGCTTAACAGCTATGACACATTCGCGTGTGAGGAAGGACGTGGCTTTTCCTAACacatcaacaccatcagtATCAC
CTCCAGGGTGCCTTCCCGTACGCCCACAACGGTGAACATAGTCTTCAATGGTGAGTGGCATATCAAACAGCACGACGTGGTCAACGCCTGGAAGGTCAAG
TCCCCGTGAGGCTAAATCTGTGGCAACCAACACATCCACATATCCAGCACGGAATGTACGCAACGCCTGAAGTCGGTATCCCTGAGATTGATCGCCATGC
AGCGGTGCCACATGAAATTGTTCGTTGTGAAGTAGGCGAGCCACCCGCTCTACACTGGCACGAGAGTTGCAAAATACTAGCACTGGCGGATACTTGGTCG
CGCGTAACACTCGAAGCAGACGAGAAGACTTCTCGACGGGTCGCATAAATTGCACATCATGAGTCACTCTTGAGACTGTTGCGAGAGCTAAAGTCGACGT
CGAACTACTGCTAACATCTTGGCATTGAGAGGCAGCCCATACAGTTGGGGCCTTGGATGGCATTTTGGCCTCGTCGACTCGAATTGTGACGGGCTGTAAC
ACTGCTGACCGAGCCAACCGCGGTAAGAAGACTGGTAAAGTAGCAGAGAGAAGTAACGTTTGTCGGGCAGTAGTGTTGGTGAACTGTAGAATTTGCCGTA
GCTGCATCTCCATATCCGGCGCTTGCAACACTCGATCCACCTCATCAACCACAAGTAATGCAACTTGTGAAAGTGACAGCGCATCTGGACGATGCTGGAT
AAGGTGCAGCAATCTTCCAGGGGTAGCCACCACTACCAGTGCCATATTGACACGAAACTGAAGTTGTCCGATCTGTGCATCCAACGGAACGCCCCCACAA
ATCCCAATCACTGGAGGGCTTGAAGATACAAGGAAGAACGCTGATAAGTCCTGAACCACCTGATCCACAAGCTCTCGTGTAGGCACAATGATCAATGCAC
AAGGCGAAGTTGGAGTACCAACCATTGACATGACCTGATACTGTTCAACCCCAGGCGTTGCTTGACCCTGTTCAAGCAGGCCGAGTATCGGGAGGATGTA
GCAGAGCGTCTTCCCGCTGCCAGTGGGAGCTAATGCAATCACATCGCGCCCTTGGAACATACACGGCAATGTCTGCGCCTGAACAGCTGATGGGGTCGTC
ACACCACGTGATTGCAACACTCTAACAGTGTTTGGAGACAACGGGAGACTGTCGAAACAGCGGACTGCTACTGGGATTGGACCCTCGCCTTCAACGACGA
TTCCTCGCTCTTGACGTGCCCATGTTGCTTCCTGCTCTGCTGATGCATCGTATGATGAGGTAGCAATATGCTGGTGCTCTTCGGATGCAGAGGAAGGAGC
ATTAGGCTCTACTCTTCGACGTTTACGCCGCGAGACGTACGCCCGATCTGTCATTTGGTCAATGAAGCTTTACCAGTTATTTAACGaatatgtgacgtgt
gaggTTTCCGTTATTTTTGGATGCGTTCGAATCTGTATTTCAGGTTAAAGTTGCATAACGATAAAATTACGCACGCAGCCTAGGAGTAGCTATCCGAACA
TGCGTGCCGCCGTACGAGACACAATGCCAAGGAtctcctcgatctcgtcctcggcAAAGCGCTTGTGCAGACTAGGGATAAGTGCCACGgcttcctccac
ttcttccgGGTTCAGGTTGGACAGACACGCGATCTCGAACTCCTCCAGTCGGTACTCCACCTTctcgccttcctcttcacgCTGAAACGCCAGCGACATC
AAAGCCCTGCACAATTGAAACAACACGGCATGTTCATGGTAAGAACAGAGCTGTCAACAGGTAGCAATAATGAGAGATTACGTACTCGCGGAGCTCCGTG
ACTGAGGCCTGGTTGGCCACGGGGTCTTTGGTGCCACTGAAGCGTTGCACGTACGAGTACGTCTTCTGGAAGACACTGTAATAGCACGCCACACATACAG
CACAAGTTTTACATTAGTTAGTATTGGAGAATCTACATATCTGCTGGGGGGGACAAAACTGAAGGTTAAAAACGCACTtggtgagctgcttctcctgcgt
CTCGTAGTCAGATTTCTGTTTCTCTAGGATAACAGCCACCTCGGCATTCGACAGACACGTCTCGTTACGGAAGTCGTCACCCAGGTTCAGCTCCGCCGCG
TCCTCCGTGTCCACCACATGCTGCGGGTTTGCCGACATTGCTCAACTTTCTAACTCGTTACAAAACACGAATTTTAACAACCTAACCAGTTCAGTATACG
GTATAGTATACAGTCAGATCGGAAGGCGTGGGGACCATAATGCTCAGCTCTGTAAAGCAGCTTAAGACGCTCGCGGCGGCATCGCAACGCACCTTCTCGG
CCAAGGCTGGAGTTGGAGGCATTGCCGGTATACTTGCAACTGTGTCTACTATTGTTATATCGATTTTTCTGCTAACTCAACGTACTGCAGGCCCGAAGAT
CACTGGCGTCCTGCGGTTCTACAAGGACGTGGGCGTTAAGGACGTAGAGGAGCCCTCCGAGGATGGCGAAGAGGCTTGCAAGCTTTATGCAGTGACGCTG
GACGGCAAGACGGTCAAGACTCCCAGACAGCAACCTGTGCGGCTGCCTACACGTGCGATGGCGTTCGCTGTGGCCCACGAATGGGACGCGCAGAGCTCCG
ACATCCGTCCAGCCACAATGCCCATCATGACGCTGGCCTCTACGGCGCTAGACCTCGGATccatgtccagcagcaccgagACCATCGACGAGATGATGCA
CTACTTGCATACGGACACTGTGTGCTACCAGGTCACGGCCGACCAGCAGGACAAACTCGTGgcattgcagcagaagaagtggaagccCATCCGCAAGTGG
TTCGCCGATACCTTTGGTGGGGAAGTGGATGTGAGCCACGGTAGTATCAGCCGACTTGCTCACGATGAACAGCTCGTGACCAATGTTCGTGGTCACCTAG
AGAAGGTTTGTTTGCTTGAATTCGACACAACTTCACAAATGGGGACTGGCTAAGGATGCTTGTGAATTGCTGTACGGTTTTAGTTGAACGACTTCGAGCT
GACAGCGATGCGAACTCTTACCAAGGAGTGCAAGGTTCGCTATTGCTTGTGACAAGCCTGTAACTTGCTGCTTATTTGCTTACACACCACGTATAATATG
CGCCGTTTGTATAACTATGCAGTCTCTGATCACTGCGATGGCGATTTTCAAGCGACACATCACAGCGAAGGAGGCTACGGATATCTGCCGTTTGGAGGAG
GAGTTCCAGATCAATAATTGGGGACTTGTGGAAGGTGGTCACGACCTTGACCGTGTTAACTGTGCGGTCAAACTCTCAAGCGCGTCGTTCCTCCTGTATC
TTCTGGAAAACAAACACTAAGTCAATGTGGTGTCTGCTACGCCCAGCGTGCTGCTCATATAGAAAATGACGGCATCTTGGATTATCCAGTGGTCGACTGT
GAATACGACTTAAGCGGTGCTCTCTTCTGTGACTTTGACTGATACATTTTTTATCGCTGAAATGTTTTGTCATGTAGAACATAGAGCTACACACATGCAG
TCACTGAAGCGCATGCTTAAATCGGATGGATTGTGAGCACGTACGAAAGCTTTGTCGTGAATTCCTTGTCGTCCTTTGGGGTTTCGCTCGCATGGTACGG
CTTCTTTTGTAGCAGGATGTAAATCAAGCCTGCACATCCGAGCAGAAACGTACAGCAGCATATTGGTATGATAAACCGCAGACTATGCTTCCAGTCGGAa
tcgttgttgctgctgctgtcgctgtcttGACTGGAACTACCGGTAGATTCGGAGAGGGTTAACAGCAGTGACTCTGATCGACTTTCCGACGAGTGCAATG
GAGCGGATGCATTGCTGACGCATAGTTTATCAGTCAGACGGACGAAAACTCGGTTATCTGCTGGTGATTTGACTTCTGGTGTCAAAGAGCTGTCTATGCC
AAGCAGCGTGAGTGGAGCCATAGCAAAACTTGCCGTATTATCCCCCTCCAGATGCTTCATGACAGTGTTCGAGACAGGTGCAGAGAATGATAGTGCGATG
GTGTCGTTACTACCACATTTATCTTTTAGCCGAGTCTCAAGCTCGACTGCGGCCGCAGTCTTACCGTTCTCCGACCACGAGGCTTCTTCCCAGTCGACTA
TCATGGCACAAATCGACAGCGGGGATATTGTAGCAGGGGAGCTGTTGGTTTGGAATCTCGCCCAAAATGAAGAAAACTCATTGTGTTGAGCCCCGTCTTC
AAGCAAAACCCAGCTCGCTGTTTGAAACAGGATCCatttgccagcagcttcagagTATCTTGGAACGACATCGAGCCACGCTTCTGAACTTGATGCGTTG
TCCACGAACACGAAGTCGATTTGCTTATCTTCATTGAAGAGTTCCGTTGTCAAGGGTAAGGATGAGATGGAGAcgttggagaagatgaacatCATGTTGA
CACCAAGCAGTGTTTTAGCCCCACTGAAGCTGGAggcaagcaccagcagcaacaatggcaaTGACTTCATCATCAGCCCCATCGTCTGTCTTTCAGCTAG
TTGGTACAACATTGTTGGCTCTATCGGcgaaagaagcagaagtGAGCAGCGGCCTGTAAATGTGAAAATGCGACAAAGGGACTGCTGGTAAGTTGCCTTT
AACGCCAATACATTGCTAACGTGGCTCTTCCAAGGTCTCATCAACACCCGTGAGTCTGTCGCGtgccaacaacagcaatatcCATGGCATGGCGAAAAAC
GTTCGACTGAAGAGCATCAGTTGATATATTTCTTCGATAACCGTCCAGAATGTTAAGCTAGCCAGCGAGCGGAAGCTTACATGCATTTTCAGGGGGCATC
GCCTATAGAGATACTCAATAGCTACCCTTGATACCAGCGCACCTAGTTACACTACTCCTTCCTTGGGCTTATAAtgccagcagagctgacaggaTTGACG
CTACGCTACTTCTAGACTAGCCTCTGCATGCTCTCGAGGAAGGTGTTCTTGTCCACGTTTACATCTCGACCGTGCACAGCGTTgcagaacgaacacttgT
ACGTGCTGGTTCCTCCCAGATCATTCTTGACCCCCAGCTGGAACAGGTCTTTGAGGTGTACTCTTCCTCGCACTTGACCATACGTCCGCCTACATgatcc
atcttgtacttaagcaacgtcttgaacttgaagtgtGACTGCCAACATTGCTCGTGCTGTCGAAGACTGGATCTTACGCGTTCTCTCGCGACGAGGAGTC
TTTCTTGTGTTCTCTTCCATGCTTTCATCTGATGAAGCCGCCGGCGTTCCGTTTGCTGTAACAACTTGCTTGTACTTCCTCACCATCTCCGCGGTCTaga
acgacggcagcagtaCTTGGTTGTAGTTAGCAGCCAACTAGCTTGAGAGCTTCTGATGCATGTCGTTGACCATCCGAGTCACGTGACGATGCCGCTCACg
atgctgtttgctcttcGCTCTGCCCTTGGTCTTCTTTCGTTGTCTTACCCTTGCTGCGACCTTGTTCTCCGGTtgcattttccacaagaacgtACAGATG
TTAGTCTAGAAGTAGCGTAGCGTCAAtcctgtcagctctgctggcaTTATAAGCCCAAGGAAGGAGTAGTGTAACTAGGTGCGCTGGTATCAAGGGTAGC
TATTGAGTATCTCTATAGGTGTGGAATAATTCATGAAGACCCCCTAAATGCAGAGCATGATAAACCTGTAATACCCTGCGTGTTATGCGAGCTCTATTGA
CAGAGTTGACTTTGACAGCCTGGTCAGTAGAACTTGGAGCGCGATTCGAACAAGTCAGCCAAGTACGCCGGGAGGTCAGCAGGGCGCTCGCGTATGGCGC
TGTTCGTGGCAAGTACCATGAGATGCCGGACTTTGCGATCAAAGTAGACCTGTCGCTTCAACTCCTACAAGCAGCCGCAAAACATTGTCGAGTTTGAGTA
CAGCGAGCAGCTTGCACTGTAGTTTCTTCGACAGTACGTACCACATAATTGTATTTCTTGAGATTGAGAGTGCCTCGCACTGCATTCGCGAGGAAGTCAG
CCGTTTGATCGGGCTGATAGAGCAGCACTTCCTCGAGTGCTTTGGTCAAGATCGGGTCAATTTTTGCCGTCATGTACTCATGCACCTCATCGAGTGCAGT
AGACAGGTAGTGGTCATGGAGGCGATAGCGCTCTTGTTCTACATCCACCAAATAGCACCCCTATTAGCACCTGCTCCCAAACAAAGGTATTGGTATGACA
CACATACCATCACGGATGAGCGCAgagacagcaacaccttTGTTCCGGATCTTCTGGGAATGTTGTTCCATCGCTGACTGCTTGAAGAATTTCGGAGCGT
TGGCAATGCAGCGACCTGCGGCAATAacaactgcaacaagagcgaTTCCAGCACAACTGACCTTCCGACGGCTCGTATTTTTAGTCGATCGGCCTCCACA
AAGGAGCCATCTTATcgttccttcagcagctacatGCCTCTGGCTCTTGCACACCGTGTACGGCGGTGAGTATCCCGTTTCGCTACATGCTAATTTGAGT
CCCACGGATGCTAGAGATGCCGTTGCGTATCCCGTCAACACCCGTCCCTAATGCTCACCCTCAGCCTTGTCTTCGTTggacttgttgttgttgcggtgGT
GGCCATCATTGCTATCGTTCTTGTAGAATGAGCGCTTGTTCTCGCGGCCCCATGCAGATCTTTGATGACCAGAGGACTTGTCGAACTTTTCACGAGAAAA
GCGAGATCCTGTGGAAGATCTCTCACCACCGGAACTCCCTTCGCCATTGTTACCACCAGCCTTGTCGGAACGCCACAGTGTCGTGTTGCGGAAACTAGAG
TTATCACTCAGCGATGTGTCGTGACGCTTGTactccagcgccacaaacTGCGGTAGGTTGAGTACCTTCCGCATCGTATCACTATTGAGGTAAACAAAAC
ACTGTCAGCTACTGCCACATCCACCAAGCACATCGTCTTTTATCCACCCCCTTACCGAATGCGGTAGCACGCCTCATTATTGTCAGCGTTCCGGTTCCAG
AGTGAGATGATGTCTTCGTTGTATCGGATCGAGATCACAGCACCGCAAATCTCGTTGCCAACATCAAATTGCTCTCCGATGATAGCCAGCACCTTGGCCA
CAGAAAGCACGTCAGGCATACTCTCACTAAGACAACAACATACCACCAGCCGTCTCCTATTACCACGTACCAGATCTTCCCAGTAGCGTGAAGCAATACC
CTTGCGCAGACGCACCATCCACTTGCCGCCTCGTCGGTTGGCGGCGTCCTCCCACATTGGTTTAATGCCAGTCTTGAAAAGGTGATAGTCCATCGTGTTG
GGCAGATCGTTCGGCCGCACCAAGTGGTTGTAAATCTTCCAGAAATCCTGCACCTAAAGAACAAAAAGCAAAATGATAAATAAAAAACAATCAGATTCGG
ATCATCAAAAAGTTAATAGCAAGCGCATTAAACCTACGGTTTTAAAATCTCCAAGGcccttgatgctcttctCGTAGCTTTCCTGTATAATGCCCAATTT
TAGCAGCATTAAAATCACATCAGCACTATAAAATAAAAAGTAATGGAACGCATTATCGTAGACGCAGGTTGCAGCTACGATCGATCTGGGACGTACGCTG
ACAGCCTTGTTGCCCGTGCTGCGCTTAATGTACCAGAAGGTGTACATGTTCTGGATCGGCGTGTCGACAGCCCCCTTCTCCACTGCCTTCCCTTCACCTG
TAAAATGATTAATTTGACATAAATAATCATAATCTATTAGTAAAATAAAAACAATGAGGAAAGCTCCCCTTTGGCAGCCGTGCCATTGAGCTACGTCATG
TAACTctagaagaagaaaaagactCTAATCTAACAGATAAGACCTATCAAAGCACTTATCTACTGTTGGTATAACGTACTGCTGCGTTTGTCTTCCCCCA
TGGCGTCGTGCTTGTCCGTCACTACTTTATTGATGGCGAACGCTTTTTCTTTCACGTCCGTTGATTGCTGCAAAGGGAGGGGGCACTAATCTATTGATCA
AGGTTCTAGATATCGTACTTAAAATGGGATTTACGGTATATTTGTATtttcaacttcatcttgcgACGAGATGGCAGAGTCCGACTCGGATGGAGAGTTT
GAGCGGTACGTACGAGGACATTAACACTATTAATGCACGATATTATGGCTACCACTACGTGCACAGGATTCTGGGTGTCGTTTACATGTCAGGATAATGC
TCTAACTCTCCCCAGCGGTGATTTTATTCGTGTTTGAACACATTTTATCAGGTTTCTACAGGATGAAGATTCGACGTCTCCTGAGCCAACTGCACGCAAA
CCGAGACCTGCAGCTTATagttcttcatcagcttcagccgtaacggctgctgcgactgcgtTACTGGCGTCGTCGAAGCTtgtgaagaagcacaagagta
agaagaagagcaagagttcggacaagaagagcagcaggaagGCTACAAAAGTGGACCTTTCAGAGTCTGAGGAGGCGCCACCAAGTTATTAtgcttcttc
ctcaactAGAGGGGGTTATAGGTAGGTTTTGATGAATGTTGTGCGTGTTCTAGTACTATTGGTGGGTGTGACTGAATGCAGATCTAGTGCCGACCCTTAT
GCGTTTGATATGACAGCATCTGCCTTTCCTCTTCCCAGTAAaacagaagaggaggaaagcaatgcaaagaagaagaaaaaggagcAGAATGTTGTTGTGA
AGAAGGTGCCAGTGAAGAGTACGCTGCTGTCAATGGAAGACCGCATCACAGAAATTTTGAAGCGTACGGGAAGTGCACAGCTGCAGGcatcagaagaaga
agaaagtgagGAGGAGCTCGACAGCAAGGTTAGTGCATGTAGCTACTTGGTTTATTTGCTCGAGTTGAGGTGGATAACACAGCTAGGATGATACCGTTTC
TAAACTCCTTGCTCCTTGAAGATCGATGAGGTGAACAAAGAACAAGTGGGAGCGGCACACGTCAGAAATGACGAAGGAGGAGCTCAGAGCACCAACAAAG
GAGGTCAAGGCAAAGAAAAAGGTAAAGACAGCAGCGAATATGGAAGCGATGCTGAACACTCGAGCTTTTCCGACTCGTTGGGGGTAGTGTCGGCAGATTT
CGAAGTAAGTCATTCATTGATTTAACTTGCTGATTTTGCATACTAATTTTTCAAGGTGATGTTCATTGCTACATTTCAATTATCCTCCAGGTTCATCTGC
CGCCCAAGCAAAACTCAATGCGGACCAGACTTTCTATGGTACGTCATTCTTTTGTACGTCAAAGTATTTATTAAAGCTAACATGTAGATAACATCGATGT
TTTCCACCACCTAGTCCAGTCTTGACAGTGAAAACTTTGCTGTCAATAGAGATGCTCTAGACAACGACCTTGGTACGTAAATGTGTGATGTATGATGTGG
GGTTGGATCCAAAATTGACAAGAAAATTGGATCAATTGTCTTTCTCTTTTGGTATGATTAGTGACACCCTCGCGCtatgaacagcaacagatgACGTTTT
CGAGATCTGATCAAGGCGATGACAGCGCCACGGAGAAGGATGAATACGAAGACGATGGTTTTGAGCTAGACCCGACAACTGAGGCAAAAGAGTCTCCTCC
GCTATACGCTCCGGCCCAAGCTAGCACTGATGAAGCTATGATTGATAAACGAAAGGAGTCATTTGTTAGTCAGTTTGATTCGATGAAGGTTAGTCGCTTT
TACTAAAGATGCACAAATTGATGTGTATGGCTGTGAATTTACTCATACTTGTATGTGTAGGCGCTGCTATTGGCTGACCCCATGCCAGTTACCGCAAACG
AATCAGACAAAGGCGAAGACCAGCATTTCCAAGACCACGATTTGAGAAATAGCGCCGCCTTTGCTGGAAGCACACCACCTTTGGAAGTCAGCAACGCGTT
TGGGTatggtgatgacgatttTGAGGTACTATCTAGCTTGCTATCTCAGTTGTTACGTGGTGAACTGAACGTGGTTGTTCCAATTGTAGGAGACCGTGGC
ATCAAAAGCTGACTTGGAAAGCTTACATGAGCCGTCGCGTAACGAGGTATGGCCTTGCAATTGTTTTGTGCAACGGCAAGAAATAATGTACTGTAGGGCC
AATCTCATTAATACGTGTGGATCTATGTTGTATGTTTGTGCCATGATGCGGGGCCGTAGACTTCTGCAGAGATTCAAGGCGTACCAATACAGGACAGTGA
ATACAGTGGTGATTacgaagatgacgatttTGAGCATGATCCTGGCACTCTGGGAGAAGAACGGGACAGTACTACGTCGCAATTACCTCCAGCAGACCCG
GAAGAAAAGCAGCATGGAATAGCCACTATAAGCGatgccaacaccaacagagATGCGCGTGTGGAGGCTCTACTCGCCGCGAAATATGGCGATTTCTACA
CACATGAAGGTGAGCGACCAGATTCGGACAACGGTTATGCCGACGATAAACCTCCGCAAAAAGAGGTGACGCAACAGGTTGCGTTCGATGAGGTAGCCCC
AAGAGATGGTGTTGCGGCAGGAGCAGGAATAGCAATGTCTACTCGTGAGCCTGCAGATTCACCTCCGTCGGTACGCCTTATCCTTCCcgctttttttttc
atgcTGCGTAACTGTTGTATCAGAAATTAATTGATCGATCATCTTTGCGCACAGAGCCCACCCCCTCCGCCTCCCCCAgccgatgaagatgaggaggaag
atcAAGAGCTACACCGCTTTGTTTTGGATAATATCGAGTATGGAACCGCGAAAACTGCTCAACCTATCGCTGCACAAGATGCAGTCTCAGTGACAAAATC
ACTAAGGCCCGCATTGgtgtcttcagcagcagaccgGTTCCGCCAGATAGAAAGTCACGTCGCCACACTACGTTTTGTTCAACCCAGCGGAGCAACATCC
ACCAGTCCAAGCAACTCGTTGTCTACGGAGGTAGTGCATCCCGTTTCCGCAGGGGTTTTGGTAGACCGCAAAGATATATCGCGGCATATGCCTTTGATGG
AGCCATTAGCAATTTCATTTGATGAAGGACTTCTGgctgaggatgaagatacTCAGCGTGAGATTGATGATTTTGTGCGCAGTTCTCAAATCCTGCGTCA
AGGACAGCGAGAAGCAGAGCAACGAGCCAATCTAGCGAGAGAAAATGGCCTGGTGTTGCGTCTTCAGCAGGCGCAGCGCCAGATCCTTCAGCTGAAGGCG
CATATTCAAGGGGCAGTAAACGGCGGTCTACTTGCGCATGCAGACGGAATCCATACCTCGCCGAAATTAACAGATACAGACAAGGAGGGTACCAAGAAAC
TACGAGCTACTGAGACACAAGGTGGTAATTCTACTATTTCCCAAGTTTCCTACGCCAAACTCCAAAAAGAAATCAAGACTCAAGACAACTTGATTGCAGC
ATTCCAGAAAGAGAATGAACGCCTTATGCAACAGCTGAAGCAAGTTCGGCAGGATGTCCACTATGACGTGCATGAAGCGAATGAAGAGCTACGCAAACAG
GTCAAGCTACTGCAGAAACAAGTGAGCGAAGTAGATTCCCTGGCCGGTGGTAGTGATACTGCTAGCAAAGCGCAATACCGCGCGGCTGTGGAGGCACGAC
TTGAGGCGGAGGCTCACGCGTTGGCGCTGCGAGAAGAGTTGGCAGCTGTCCGATTGACTCATCAACAAAAGATCAATGAACTAACACTGGAGATAGATCG
AGTGAAGAAAGCTAAGGTTGAGCTGGAATGCCGTTACGAAGGCGTAGATCTGGTCCAGGTGGCGCAGGAAACCCAGCATGCACGCAAGTTACAAAACGAG
TTGGACTTGTGCAGGAAGGAGCATACTCATGCTCTTGGTGCACTtcagaagaagctggatTGGTATGTGGAAAACCAGCGGCTATTAGACgatcaagatg
aagagctgcgGCGACTACGTCATGAGGTTGCCTCGCAGCCCTCCAAGTCTCCTGCTAAAACACCTTTAAAATCCCAATCGTCAAATGCGCTGGCAGATGG
ACCATCCCCTGCTCGCTCACACCGCCGCTCGCCAAACGACATTCGGCGAATTCAAGAACTTGAAGGCCGACTTGCAGAGGTAGAAGAGGCAATGCGACGC
CGACACCCCGACAGTTTGACGAACCTCATTCTGGCTTCTCGCCGTGCGGATGAAGAATCCAAAACCCAAATGTTAGAGCACGACTACGAAGAAAAGCTAG
CAGCCTTATCACGTGAGCTGGAACAAGCCCATGAAGCAAGCGAAACAAAGCTAGCGAGCttccgacagcagcaagaaaagcTGCTATTGCAGTACCGCCG
CAAAATCAAGGAGcaagagaagcagctcaagcaactGAGCAAGGCTCCGCTGACACACAGAACACCCTCAAAGGAGGCGGCCAAATCAGTAGGAGCTACT
ACCGAATCAGAGGTGGCGCGTGTTCGTCGATTCTACACAGACAAGATTAAACAATTGGAGCGCAAGTGGGAGGCCAAATATCGCTCCCAGCGCAAACAGC
AGTTTATGGGGCTAAGTCACTCGGATAacaaccaacagcaagatgGACTCACATATGCCGACTCCACCGTTGTCATTGCGAACTTGCAGAGGCAGATACG
AGAATATGAACTTGAGCTGAAGCAGGAGAAAGTTAGGGCTGACCAACTTGAAGCCGATAGCCATTTGGTCGCAGATGCAAGCGAGCGACCTGAAGGCCCA
TCTTTATCCAAAGACACAGATTTCCAGCAAATGGGTCAAAACCTACAAGCTAGGACAAAGGAACTTGAAGGACAAGTTGTCGACTTAGAAGCACAGTTAC
GTGACAGTGAGAGTGCCCGGGGCCGATTAGTACAAACATTGGGTACTATTCACAACTTGGACGTTAACCGATCAACAGCACCtgacagcagcgcaaagCC
AACAACCCCGGTGATGGAGCAACCTACCGAGCCAACCACACCCATGACCGAGCCTTTGGTATCCCAGCAAAAAGAAGCGGAGTTGGCGCAGTTAAGCCAA
GAGCTAGCCACAGCCCGAGAAGCTTTAAGTAGCGAACAAGCCGCTTCCGCCGAAAAAATAgttcaacttgaagcgaaAGTCGTCGAGCAATCTGAGAAGA
ATAAACTGCTGGAGACTCGGGTGACTGACAGCCAAAGCGAAATGCAGAATTTACAGACGCTGGCAATTGAAGCCGAGCGACACAGCCGTTCACTTGAATT
GCAGGCACAGCGTGTACCAATGCTTGAAGACGAGGTGCTGTCATTGCGTCGCGAACTAGCGTTACCGCGCACGCCATCTATGGTGCAGTATCGGTCGCTG
GAACTGAAGGTGGCAACTTTAGAACAAAAACACAAACTACGCGAGGCTGAGCTTAAGGTCGTTCTGGACCGAGCGTTAGCGTCGAGCAACCTCGAGCGGC
TAAGTCGTGAACATGCTCATAGAGCAGCAATCGCTGCCAAAAACACCGAAATTGCTTCTTTCAAGCGCCAGCTGGAGGAAATCATCAACGAGTTAGCGCA
ATTGCATTTGCCGCCCTCATCACGGCGGCTCAGTACAGATACAAAAGCCCATGAACCTGTAGACGACGGTGTGCAGATGCCATGGTAGAAGACACAAACA
GGATAGAGGTCGAGTAATTTGAATCGGCAAAATCTATTGGAGCGAGCAGTTAAATAGCAGAAGCACAGAGCGTAAGAGCTCTCCAAGCCTCCGCAGCTAC
GTCCCCAATGCACGAGACGAGTTGTCCAAAACGCTTGTTATCGCCAGAAGCTGGGAAACTCTTTGTGTACCTGGGGTTTGCTGTTGGATGGGGTTGATCT
GGAGATGATTACAATTGCTCCCTTGCTCACGCTGCGTCGTAATGGCTATCCTGTATACTGCCTTAGGTCATGGAGTCGATGAGAGCGCTGCGCATGCTCG
TGGCAATAGCCGTGGGCTGCGCGTTCTGGAGCTTGAAGATGCTCTCGACCACCGAAATCTCGGTCGACGTGGTGTCAAGACCGCAGAAGGCCGTCCAATC
GTTCACCACGAGGCCGGCGCCAATGACATCACTACCACGGTTCACCGTACCGGCCACCACGGGCACCTGTAGCAGAGAACTGAGCTCCTCCTGGTCTTCA
ACACTGGTACGGGGGTGCACCAGACAGCCCTGGTTGGACAGGGCCGAGTAGCTACCCACAAGGGCGTTACCAGCCACCGTCTGTCGGAACACTTCGACGC
CCAATGTGTCGGCCACAATCTCCTCCGTCTCCCGGTCCAAGTCCGTGTGCACGAGTGCCACGTGATCGTTGGTGGCGATACAGTTGCCCAGAGCTGAGAG
TCGCTCCTCCACACGCTGTACGACGACAGAGTCTGGCAGAGCGTTACGGATGTGTTGCATCTCCTGGtccgtcgtggtgctggggAGCAGCAGACCGCGC
TTGTTGCCTACAGCCACGCGACCCACGAAGCGGCATCCAGCGATGCTGGCGTGTACCACAGGGACGTGGTCCGCCAACTCCGATTCGAACGTGCTGTAGA
AGTTCTCGGATCCGCCCACGCAGACCAAGCAGTACGAGTTGGTGAGCTTGGAGAAGACGCCGATCTCGTTACTGTTCTCGAATTGACAACGTGTAGCCAT
GACTGAAGACAGatacaagaagaagagagagagagagataAGCGAGGTAGCTGAGTTGGTCTTGCTTGGATTGAGGAATGAGCGGAAGCTCGTCGCTCCA
GCCAAAATCGGTGGAGCCAAACAGAAGATTCCGGGAATGATGTAGACCACGTCACATAGACCAACACTCACTTTCTGAGATCTGATCCCGTGACATACCA
TTCTGAGACGTATTCGTATGACGCGCTTAGTTTGACGGCGTACGTGGCGATAACGATCTTGAAGAGTTTTTGGCAGAGCGCATCGGAgccatctgctgct
tctcgtccTTGCAATGCTTGTGACCAtggctgtacatgtacaggCGATGCCTATACATTGGCACTTCTGATCCCCTTCAGATCTTGAAACCTTCGTTGTC
TGTGAGTGTGTGCATCAAATTACAAACGAGTGCCATCATGAGACTGAATCCTCGCACTCTGTTGTGCTTTTCAATGGACGAGCTGGTCTACATATTCTCG
ACGTATGTCTGCAATGAtccacaagatgcagacgtCTGTGACGCAATCGAGCAAGAGGACGGAAAGAGGACAGAGAGTCAAGACTTGCGTGGGCGTCTGC
GGTTCGACTCCGACGAAGTCTGTGCGTGCGTCGTTGACCGACGCAGGTacatgatgaggaagaagacattTGATCGCTCGATACAAGCAGTGCGTAGTGC
TAATCTCCCTGACTCAGAGTAGTTGCGCCTATAGAAATCTTCATAGCTACCCTAGATACCAGCGCACCTAGTTGCACTACTCTTTCTTTGGGCCTATAGC
atcagcagagctgacaagacttcgatgaaggcatcaccgattgatGCGGGGCTACTTCTAGATTAGCATCGCTAGATATAGggcattgctgcttgatctt
ggaCGACGGGCTGCGCACCCTAGCTAAAGTCACGTCGCTGACGTCTCTCAATCTAGCTGAGTGTGGAGAAATCACGGACGCAGGGCTTGCACAGCTGTCG
ATGCTCGTCAATCTCGTGACTATTAATTTGTGGTATTGCACCAAGGTGACCAGCTCAGGTATCAACCACCTAAACCAATTGCCAGCGGTCAATGTTGACT
ACTAGCTCACAACACGTATTCGTTAGATCAAGACATTTGTTTCAAAATGTTATTGTAGCATCCATTCTGTGTTGAAGCAGTTTGATGAAGCTATAGTCAT
GTTCCGGTACTGCTCGATCTCGAGGCTTATCTGCAACACTTTCGTTTGGTTTTCGTCCTTTCAATTTGCACCGAAGTGCAACTTGGGTCAGCTTCATTTA
CGCTCCCCGTCGGCGCGCAAGAATGGCAGCCAATTCGCTGTTGGCACCACCAATGGCGCCGCCATTCGAGGAGGAACCTTGTACGTTTTCACCAAACTTT
CGCACAGATTCCATGGACCCCTTTGCTGCCTTCCTAGCCGATGACGCGTGCTTCCGAGCCTCTTTCTCGgcctgcttcttggctttcttTTCTGCAACGC
GGCGCAGACGCTCTGCTTCGCGTTCTCGACTGCGTTGCTCCTGGCGTTGGGCCCGCATTGTCAACTCTTCCTCGCGCTGTCTTTCAAGTTTCTTGCGGCG
CGCTTTTTCACGTTTTCGTCGCTTGCGAATATATTCTTCGGGAACGCCTGGAGCCACGTGAAGTTGTACACTGTTTGCATCACCTGTGATTCGATCATGC
CCTGATGACACGAACTGGATTTGTTGTGATGGCGATTTCGACAACCCAGCACTAGCCGCCCGACGGAGACGTATGGAGTCGTTGAAACTGATCGGTGTTA
CGATGTTTGCCAGAGAGCGTATAGCATCCACAAGAGTGACAGCGATCTCTGTCTTCTTTTCCGACATTAGTAGCTGATCCTCGGGCATCTCGGTTGACAT
GAGACCGATAACTTTATCGTACACCCGTACAGGAGAATAGAAACCCAGATCTGGCACCACTTCCAACTGCTTGCAAACATCATTGCAGTAGATCTTACCA
GTGTAGCGACAATGATGGCGGCGATTGAACAGTCCGAATTTTTTGCCAGTAGACATGCATACCATCGTCGACTTGTTGTCCACCCAGTTACGTTTGTCTG
GTTCCGCAAGAAGAGGTTCTTGGTGTACTTTCAATACGAAGTACGGATCTGCCATTGTACTCATCGTGATCTCTTCGATGGCAGTCAACTTTAGGCGACG
GCGGAGGTAAATGAGAGGTGGTATCCACGAGCTTTTTGGGTCCAACACGGGTTGCCATAtgcgcttctccatcaaATACAAGAACTGGTCGGTGATGATT
AAAATTCGCCCAGCTATTGCGACAGGAGAACCATTGGATGAGCCTCCACTGCAAGCCTTCTCGATCTCATCCATAAACACAATTTTCTCTGAGTCTCCAT
AATGTTGAATAATCCCCATGCACGCTTCGCGAATTTCATCGTTGCGCAGATAATCTCCGTCAAATGGGCGGTAGATACTCACACGCTGGCGCTGTTTGTT
ATTCGACGTGTACAGCTTCGTAATGTCGTGGTTGAGCTGTAGTAGATGTCGGCGGCCATAATACTTTTTCCAAGCCTTTTGGATTCGCATGGCAAAAGAA
CCCAGCTTCCTctcacgcagcttctccagctcgaAGATAGTCTCAGGTGTCTGGATAAATACCATAGTCTTGCCGAGCTGTACCTCCTTCTCAAGCTGCG
GGAGCGACTTGACAGCGGCACGTAGAATAGCTTGTGTTCCCTTTTTGTCCGATCCACGGAATTCCGGGTACGTTTCCTTGCTGAGCAAACGGAATCGATC
CACAAAACGCCCGTAATCTCCACGGTAGGCGTAGCCGGCACGACGAACTTTTACGTTTTCAAGGAGACCGAGATACTTAATCTGATGGATCACTCGACGA
TCATCCATCTTGTTTGACTGTTTTTGGTCGTTCGACTTGATGCATCTGACATAGTGTGGGGTGCAGTCCATTAGTGCCGTCACTAGTGCCTCGCACTGCG
TGCGGATCTTGTAGCCCGCAGTATTTGCCATGCGCTTGTCATTGAGGTCAATCTCCTCGGGGAAGATGTAGCGCATCAGCTTGTTGGAGGTCTCACTAAT
TATTAGAGCGATGTCCTTGCTCAAAAAGTCCTTGTTGGCATCTCCAAAGCCATCAATGTTGTATTGCACGTCACCTGCGTAGTGTTTGATTTCAAAGGTT
TTTCCACGCTTCGAGAAGTGCGGGTGTGATTGGTGTAAACTTGCCACTTTCTCGAGAAAGTTAGCGTCCACACTCTCTCCTTGACGTGAATGCATCGTCT
TGACCGTATCGTCAAGAATAAGGAAGATACCAGGCGTAGGGCGCCGCGACTCAATCAAATCGCACACAACCTTGTTGTTGAAGAACGGGATCGGTGCCCA
AGCGATGCCCTCGCGCTCGTATTCCTCCTGCTCACTTTTTAGCGTCAGCTCGATGAAaatttgctggagcttctcaTTCACGTAATTGATGCAAAATTGT
TCAAAACCGTTCTTGTCGAAAATCTCAAAGCCATAGATATCCAGGATACCAATCGTAGTCATATCGTCGATCTCCAGAATTTCGCCATGTTTCTCCGCTT
TCTTCTCAATGTCTAGTGCGTGATTCACACGTTCCACTAAAAAGTCGAATAATCGGTCATACACGGCCTTAGCAATAGAATCGCGTTGCGATTTGGCCTG
GCTCGTATTCTGCGGCACTTCATACGACTCAATCTTGCCACCAGGTGCcattgtctgcagcagcttaTAACATAGAGCATGTTCCAATCGTACTGCATCA
AGTCCCAACAGCTCACACGCGATCTGCAGACTCTCCCGGTCGCGCACCGAAGATCCTTCTGCATCTCCCACCGTCTCCGGTTGGAAGTGCACATTGCCAA
TATGCAACACAGCTGCCAGTGTCTGAACCACCAACTCAATTTGTTTGCGCTTGATACCAACATGTTGCATGGCCGCCATGGTCTCATCAAACTCCTGTGC
GTCATTCACATCGTCCACATTGTAGCACCCACTGGCCTTCAGGTACTGAAAGCTATCCGGTCCACCTCGATCCAAGTACAATTTCtgtttggcagcagca
ggaagcccAGCCAACACCTGATAGAAAATATGAAAGTTCCGTTCTCCTTTTCCCGGACGTACGACCCTGGACTTTTCCAGCAAATAGTTGGTGACTTTAC
CGCCTTGTGGACGTCCCGCTGAGTCAAACATCAACTCGAAATACTTGCCAAAGCGACTAGAGTTGTTGTTTCTTAGTGTTTTGGCATTGCCAAAGGCTTC
GAGCAGCGGATTGCTCTCTAAAAAGGTGCGTTTGACCTTATCCACTCCGGCGCCGCTGCCACTGACCCCTGCAATGTAATTCTGGATCTGTTTAGAGGCT
TCTGTCTTGCCTGCACCACTCTCTCCACTGATAATAACACACTGATTATCCTCTTCACTTAACATGGTGCGATACGTCTCTTCAGCAGTTGCAAACACGT
GTGGAGGTACATCAATCCTCGCCTTGTGCGTGTAGAAACGCATCGAGTCTTCTCCGTAGATATCCAGCCATTTGTAAGGGTTGACGACCACCAAAACGTG
ACCGATATAAGAGTAAATGACATCTGCAGCGTGGCGCATCTTGAGGTTCTCGAGGATGGACGTCTCGGTTACAGTGGGGAGCAGAACTAGGTCGTCCACC
CCCACGACGACACGCTCGTCCGTGAAGAACGACGTGGTCGCTGTGGGCTTACGCCGCCCCATTGCTGacaggaggaagaggaagggAGGCTGCTTGAAGA
CTGACTCTGGAAGTTCGCGAACTGTATAGGAAGATGACGGTCTGGGGGGAATCAAAATGTGCGACATGTGAAAATAGAGTGGACCACATTAAAATATAGC
TCTGCAATTCCTATAAGCTTTTGTATTGACACTTGGTAGTATCAATGACATACTTGCCACTTTGAGTAGCGCCACCTCGCTCTTGCCACTTTGAGTAGCG
CCACCTCGCTCTTGCCACCATCGATTGCTTCTTGTAGCTCCGTTAGAAAGCACTCACCTGCAGTAACATCGGCTCGGACACTCATGAAAGGCAGAAGCAA
CGTCCGCAGCAGGAGATCATAGAGAAAAACTTAACGGTAGCTATCGTCAGAAGTGTCCTGCAAGAACAACTGTGGTCAACAACTGGAGGATCAACAGAAG
CAAACGCGGCTCCTGCTGACTGTGGGCGATCAAAGACTGGGCAATCCTTTTCTGCCAGAGCGAAGGGGGTCTCCTTGCCGCTCACCAAGGTCTTAAAGAT
GTTGAGATGGTGGGTATCCAGCCCTACAACAGTAGACTTTGAGGTTGGGGAGTGGCGGAACGTGGTGGCGTTGATCTTGCTGTAGTCCCGCTGTTTGAAC
TACTTGTCTCCAGCTCAGTCAAGTGATAAACGACCTAGACGACGAAGTCCGACCACAAGGACAATCAAGGAGATTATGGCGTTCGGCCGCAAGCGCTTAG
TGTTGCACTAGCAAACAAAAAGCAGGTCCAGTCCGCAAACAGCCTAGTCGATATTGCTTCAGGTGAGCGGGTTCTACTGGAACTACAACAAATGATGTCG
AGAGCGAATTGGCGCAAAGTGATAAGAGAGGAGACGGAGCGATGACGCAGTGTGAGAGCGATGCCTGCATGAAGCCATTCCCCGATTGAGGGATTAATCT
ACCAAGTACGCTAATCTTAATTTCCTCCACTCAACCACAAGAATTGACAGTCGAATATGATGTACGCCGCGTGACATGGTTCCCCTCCAACACAGTTTCA
TTGTGCACGTTTTCCGGCAAAAACTCATGCTGGCCAACGAGTTGTGCTAGCCCCAAGTAGAACGAAAGACAGTGATAATCGTTCAGACATAGTGATGTGG
TCGTACATGTTGGAGCCTGCAAATTCGCAGGGCAGATCGCTCGAGCAGTGACGAACGCAAAACTGTTTTTcagctcagcagcttgctgtCAAGCGATAGA
AGCGTTTTGTCCACCGTGTCGGtgttcgtcgtcgcttgAGCTGGCGTGAGGCCTTTAGTCAAGAGCTTTGACGAGCGACGATATTTCGTCATGATTGATC
GCCTGCGAGGCACTTACAGGTGCGATTTTCTCTCGTGTCATGTCGTTTTGAAATTCTCGTCATGACGCGACGACGGCGCAAAatcaagcagcaccaccgt
CTTCGTGAGGTGGTGCGAAGTCTCAACTGAGACCTGCAGGAAGCTTTGCGATTGCCCTCACAGCATCAAAAATGGTCATTATGTAATGACTCAAGGCCCA
TAGAAAGCGAATTCCGTCATGACAGACTTTTGTGCGTCTTGTTCTTTTGGTGGCTCACCCAAGCATTTAGTCGTGATGGGGGAAATTGCAGGTTATCCCC
ACTAGGTTACACACGGGGCTATCAAGATGCGTTGTTCGTAGCGTTGGAACGTCGAGTGACCGACTCTGCCTTGACGCGCGCATGCATTGCTAACATAAAT
TTGTGCGCGCATCGAGATGTGGTTTATTGTGGGTCGGCACATCGCTAGGTGGCTAAGAGACACATCAAAGCGATTTTTGAGACAGAAAGCCTTCGACCAT
CTCGCGATCTGGTCTTTCGAATCGAAATCCATTGGTCTCCCTAGACTCATGTGGACAATCCCTACTTGCAGGAGAATCCACACGCTGCTCCTGTGAGTCA
AGGGCGGAATGGGAAGGGCATTTGTATAACTTTCAGTATGCTCGGAGCTTGAAGTGGAGACCGAGGATGCGCTGGCACATGAATCTTCGAACTCGCTGAC
GACAGGATGCGGCGACTTCTGTATTAAGTTAATTTTGCAATCCACGACAGATATCTCGCAACTTTGAACTAAACTTATACGGAATATTTTCGTTTGTCGC
AGGCGGTGCTCTGAGTTTTCCAGGCCCGGCTTTGAATACTTCAGTCGCGGCTGTGTTCATAGCAACCTCGCGCATGATGGCCCATTTCGCCATAGAAGTT
CCTGGCCATGGTGATTTGTGTGTATTTTTACCTTAAAATGCCGATTGTGGGCATCTTTTGAGTTTTGTTCAACAAAGTGCTTTTGGCATCTTGTTGGTCA
CGCTACAGGAACAGCGCTCTTGGAGTCGAACGCCATGTAGCGCGGTCATATAATGACAAGCTTCTCTTATTCCAGGTGGCTGTGCGAttccttcttcgtc
ggcagCTCTAAAACTCAGCGACGAGCTCTGTTTTCTGGCTTGCTCTGGCATTTCAGACCAGAACCACACGTGCGCCAACTGCAATCACTGCAATCAGCTC
GGTGAGTACAAGCACCCATACTAGCACCCAAACAGCCGCCTATATCCTGCCATTTGGCTTTGGCGTGATGGATTCTGCCGCAGCCGCTGCTGGAAGCAGT
TGTTCACACAGCTCtctctttgctgctggccatGCAAAATTCGCCTTCGGTTTCATCATTCCAAGTCGTTAAACGACGAACAAGTCGCTGGTCAGTACAG
TATAGCTATCTTGCTTGTCGTGCGCCGATCGTGGCAAGCCTGTTAGTCTGAACGCGAGGGAAATTACGAAGTACGACCGCAGTTCGCCATCGGCGAAATA
ATTGACCTTCTGCATTAACCGACAGTCTTTCGGGCAAAAAGCGTCTGGCTGCGCACAATTGAGTGGCGTCGCTCCCTGTTTTTGGCCGCTCTTAGCCATT
GCTTGTCTATCGGCGAAGTTGTGCGCTCAGCATTTACTCCATTTAAATGTTCCAATTGCAAGGATGATCGCTTTTAGTTGCAGTCTACTGCAGACAATAA
CAACGCTATGCTATATCGGTTTGCCACCATCACGAGCGTTGTCAGGATATCCCCAGCACGTCGTTTCACGCCGACCCTACTCTCTACTGTTCTTTCTGTG
CGCCTTACACACGCCTCGGCGACGGCTCGTTTTTGCCAGCACTCCGAGTGTCTCTGGTTTCTCCCTCTCGCCCCAATTCTCTTTGGCCTCGCGCTCGCCA
CTCTCCGATTGGGCCTGGGAAGGAAACCTGAAAAAGCAGCGAAACGGCCCGGTCGCTTTAGCCACTTTAGCCACTTTAGCCACTTTTACCATGACCTTCG
CGCCCACAGCCGTCGAGACACTGAGGCCCACGCCATCCAAGCCCGTGTCCCCGTCCGCCACCGCCACACAGCCCAAGCGACGAGCAGGAGCCAGCCCATC
CTCCGTCAAGGACCGCACCGTCGTCGTGTTCGACTGGGACGACACCCTGTGCCCAAGCTCGTGGCTCCATGCCGAGAATTTGCTACCTAAATACCGCGGT
CATCAAATTGCCGTGACCCAAGACCAACGTGCCGTCCTAGCTCTAATTGGAGATCATGTCGCGCGACTTTTGCAGAAGGCGGCTGCCTATGGCCCCGTGT
TTGTCGTAACCGCAGCTGAACACGGCTGGGTCGAAATGTCTTGTGCTCTATATCTACCAGCAGTACAAGAGGTGCTGGCAATGTCGGATGTACACATTGT
GTCGGCAAGGAGTTGGTACGAGCAGACGTTCGGTCTGGGAGGGGATTCAGCCACTTGGAAGCAGGAGGTGATGCAACTGATTGCCCGCAAGTGCTtcgcc
gcagcagctcaagagaACAGTGTGCGGACTTATCCGGAGGCCAATGACACGTACTTCAATTTCGTGTCGGTTGGAGACTCGATGGCAGAGCGAGATGCGT
GTGTTGCCGCAGTGGCTAACGTTGGTCACACCTTTGCCAAAACGTTAAAATTCGTGGAACACCCTAACGCTGAAGaggttttgcagcaagtggagcTGAC
GCACGACTCGTTCGAGCAAATGTGTGGGTGGGATAACAACCTCGACCTCCGGCTATCAAGGGCGCAACTCGCTGAACTGCGGGGCACACCTATTTAAACC
AAGTGCACTAGACACGGTTAGGCGAATCCGTTAGTTAATAGAATAGATGCAAGTTTTTATACAATACCAATGCAGCTCAAGTAAGCTTTTACGAGTGTGT
TATAGCAACACTAAAAACATGAGCTTCAGATATTTTTTGTTCGCCATCGCGAAACCTTCATAAGGCGTCGGTTGAGATCTTAGCGCATTGCGATGGTCTC
GAGTGGCGACAATTCGTTTGCGGAGCGGCGGCGTCTGCGTGTACGTCAAAATTCGTCAACTTCTCCCCTATAGCTGTCTTAATATTGTGTCTAAACGTTC
TCGTTGTTATGAGTAGAAGTTGGAGAATCAACGtctggaagaagctgcacgacaacgacaagaagagctgaaAGCACAACACGAGGCTGACCGGAAGCGC
CTGGAAGATGGTGGGAAGTTAGCATGCATTTGTGCTTAATGTTTTGTCTCATTGTTTGCGTTGAAAAACTTGTAGAGAAATTCGCAGAGGAGCAACGGTG
CTTGCAAGAGCGTGAAGAGATTGTAAAGAAGAAATTGGCAGAAGCGGAACAAATCGCCAAcattgaaaatgaagaacGACAATTGATTAGCGACGTTGAG
AAACAGCTGCGGCTTGTTGGGGCTTTTTGGACGTCAACACTCGAGTTGCCGCCAAACGGCGACCGTAAACCTTTGCCACTCTGTGCAACTGTGCTAACAG
CGCGAGGTTTAGAGAGTTCTATCCAAGGTGTGGAAGATGATGTTATTTTCATTGCTGACAACACTGCCAAAATTCATGCGTACGACCGGAAAACTCGAAG
TCGCTTGTTTAGCACTACAGCTGAAAGTTTTGCACTACAAACACCCTCGGCAATGACCACAACTCGTTGTGGTCGTCTTTTAGGTAAGCACAGAACGGCA
ATCTTGTGTCTAAAAACTATAGTTAAGCTAATGTTTTTAAGTATGTGACCAGGAGTCTGGGCGAGTTGCACTTATTGAGCTTCGAGTGCTTTTTCAACTA
TACCGAACTTGTCTACTCTTTATCCACGCACGGGATGGGAACCCAGTGGAGTTTGACGCAACAACAGCTCGAAAAATGTTGTTCGATGGCAATTCGCAAC
TTAAATCGCCTCGCGGTCTAGCAGTCGATGACGCGGCTGGGGAAATTTATGTCAGTGACGAAACAAAAAATTGTATCCGAGTGTACAAACTGCCAAAAGG
TGTTGCAGTCTTTAGTAAGGGGAATGGTGGAGGGTTCGATCGGAGTATTGCTGATGATCCGTCACAAAATATTCTGAAACGACCTGGTGCTTTAGATACT
TCACATTACCATATCGTGGTATGTGACGTCGGGAATTCCAGGTTAGTCATTTTCGCGAAAAGAGGTACTTTCGTACTGGCTGTGGGGTGCAAAGGAATGA
AAACGGGGGAATTTCACGATTTACGAGATGTGAAATTGGCGAACGTCCGAAAGGTAAGAATTTACTACATGCACTAGTTTCCATGGTAGTCGTTAATTTT
TTCCGGCATTCGTCTTGTATTTTAGCGGGCCATTACAAGAGGCGTTCAAGTTGAGAGTGAAAGTGGTGTCTGGAATGAACATTTTGAGGCGATTGTTGCA
GACTGTGGCAATTTTCGTGTACAAATTCTCAATGAACGTGGTGAATTTCTTCGGCAGTTATCGTTGCTTGGGAGTGTGGAGCAGGTGGCTTTCCAACGAG
AACAGTTTGCGCACTTGAGAGCTGAAATCGCGAGGGAGTATACAAAATTACGTAAAACTCCACCCATTCTCTCTGGTGAGAGCATGAAAGACATTTATAG
TCTCGCGACTGTGTTGCATCCATCTTGTCAACTTTACGCTCGTCTCATGACCTACCAAATGGAGTGGCGGCAAAAGCGATCGCACTTCCATCATCCATTT
GCACTGGCCTATGCTTCATCTGAAAAGGAGGTCGTAGTTGTGGACCGAGAAAATGCTGGCGTGTATACGTACAGCTTTGGTTCAGCTGGCTGCAATTGGC
TTCAGCTCACTAAGAACGAAACACAAGGTGTCCGTAGCGTACATAGTTCTCTCTGGTTGACCTTAAGTTCCGATACTACTGGTGGCAATGACCAGACTGT
GAAGAATGTGCCCATGGAGCAATGGCTATATGTGAGTGATCCGATCGCACATCGTGTTGCCGTATTTGATACTCGTGACATGACGTTGAAATTCTTCATT
GGCGCAACCACCTACGGAGATCAAGAGTTTTGCTCCAACGGTTTTTTACCGGGAGAGCTCAACAGCCCGTCATTCCTGACAACGTACAATGAAGGTTGTA
AAAATGACGCCGGGGGTAAGAGCAACGAAACAGAAGTGCGCAACCCACGAACTATGCTAGTTGTCAGCGACAGCGGCAATCACTCTGTATCAATTTTTGA
TGCTTGCGACGGATCATTCTGCGGACGTATCGGTGAAAGTTTTGGCCATTTAGACGGATTCTTGGACACACCACAAGGTGTTGCAGTTTGGGACAATCGG
CTGCTTTATGTTTGTGACCAACACAATCATCGGGTGCAAGTATTCGACTTGGTGACTCGCTACTTTGTCCGTACTTTTGGTCGCGTGGGCGTATCACCAG
GTGAGTTTAATTTCCCGACTGGACTGGCAATTTGTCCAGGACTCCCCGACGTACCGAAGTGTGATTTTGGTCCACACCGTTACGCAAAAGTCGTAGTCGC
AGATACAGGCAATTGCCGTGTGCAGGTCCTTGACCTGAACGGTTGTGTGCAGCTAGTGTTGGATGCAAAGATTACACCATTTGACCAGCCACTTTCTCCT
GTCGGAGTTTGGGTGGAGCAACGTAGCGGGTATTTACTGGTTAGCGATGTCGCCAACCGTTGTGTGGCCATATTCACAAACAGTGGCAATTTCGTAACAG
CATTCGGCGCcactggagaagttgatgCACGGTTTATCCAGCCCATGGGACTAGTCATTGTTTCGCAGACCGCAGGCCTCAACTTATTACTTGTCGCCGA
TGCAATGCGCTGCGATGTCAGCACATTCCAGCTGAGGTTGTAAAGAACCGGCCACAACATTGATCTATATTTCTTGCGTCACTTAACTAACGGTCAATCA
CGCAGGTTAATCTCACTCAGTTCTACGTCATCCCCGTCTTCACTGCTATCAACTTCTGAATTCGACCGACGGATgcgagaagctgaagaggttGTCGAAA
TAGGCGCAGAAGCTGTTGTCGAGCCGCTGGTAAGGTCGTCCAGAGGTGTGTATTGGTTTCTCCACCGCTTAACCACCGCGATAACCACGACCGCGCATAT
GGCAACGTTTGCAACCACAGCGGCGATGAGTAGCACACTAGTCAACGTGCTCATCCCACCTGGActgctgtttgtgctgccGTCCGTCGAAATCACCGTG
TTGGACTCCGTGCCATTAATCACCGCAAGCTTATTTGTGTCAGGAAGGGTggacacgttgaagtggtctTCCAAGTTTGCGATGAAGTCGTTGATCACCG
GGAAGTTGGGCGTTCCAACACCAGACACTGCATCCCAgccagctgcagcgctaAACGAGTCCTCGCACGGATTGTTACCGCCTCGTGGGGCGCCATTATT
GCCCACTACCACGTCGTGGAACGCGTCCGCGCGATTCTCTGCAAGGTAGTACAGGAGTGGGTTGATGAACCCCAATGGGCTCTTGCCAGCGTTAAGGCGC
ACATCGTTCCACAGTGTCACCATCGCGCCAAAAACTGGTGTTGAGGCTGACGTTCCTGACACAGACGACAATCGGCCGTTCATATATACGAGATAGCCGG
CGCCAAGCGCCGCTACATCAGGATATGCACGTCCACTAGCGTTGAAGAAGTCTGGTCGAGTCGGAATATCCCGTGTCGTCAAGTATCTTTCCACGGCTGA
ACGCTGGTACTCCGGGATTGGATAGATGTTGGAGaatccaccaccagaagtGATGATTCCACCGTTCTCCACGCTACAGATCACTTCCTCGTTTGTGCGG
AAGAATGGTTTAGACGCCTGCTGAGCTTTTGTCAAAAGCATCGTGGCGCCGACAGTGGTGATGTATGGACTCGAAGACGGCCATTGAGGGCCGCTTTGCT
TGCACATATCTTCGGCTGGCACCTTCTCGAATTCCGTGCGTAGACCAGTAACACCGTCATCCCCACTGGCAATTAGCACCGTGATTCCACGCAGCCCCAT
CTTGATCAGGAGAGTGTCCAATATCCGGGCATAACCTGGCGAGACGTCAAAAATATGTTCCTCGTCATCCGAATAACTAATCGAGACGACAAGCGGTGGG
TTCTCTAGGGCTAGAACATCCTGTGCAAATTCAACAAATGGCTCGTCCTCTGACGAGTAGGGATTACTACCATTCATTGTCCAGACGTACGTCGTAGCGT
TTCGCCCCACGCCCGTAATGTACTGAACGTCCAATGATGCCTCAGTACTAGCCCTCTGCGGTTGGTTGACTCGACTTCCTTTGTCAATAATGCGTGGAGG
ATTCTCTCCAGGCAAATATTCTTTGAAAAATATTTCCAGATCGGCCGGGTCATACGATTCAGTGTAGAACGACGGCACGCACTGTGTGTTGCTCGGGTTG
GTTACGACAAGGTCCTTCGGGATAGCGTACGTATCTCGAATTGCAGCCAGTGTGCCACCTCCACTGCGATTCAACTCAGTTGTCTGAGATGAAGTGGCTC
CAAGCGCTCGCAATCCGAGCGGGTGCGTGTTCACACTCAGAAATGACACGATACCCTGCAAATGCTCCGGCAGTTCAACATCAGAAACAGCACGCAGCAA
TTTCCGTCGACTCGATGGTATGTCGTGTGTCATCTTCGCCTCAAAACTGTGGATCTCAGCGCCCAGCAGTCGTTCCACATGCTTGACCTTCATAGGGATT
TTGAGCAAATTGGAGGTACTGGAGAAGGTTCCGACACTGGTTTCATGCGTCCAATGCCCAACCCATGCTCGAACTGCATCTACCGCACCTTCTGCTGGTC
TTGAGAGTTCATTAACTCTCTCTGGGGCCAGATATTGGCCGTAAGATGGGTGTCTACATCAGAGCATTAACCACGTCACACATTCAGTATCCTCTCCTGT
CGCTTTCATTGCAACTCACAGCGTTGCATTTGAACGTACAGCAACCACATTGTATAATATAACTTACGAGGGGTTTGATACGCTGTAGAACGCAGTCTCT
AAGGCTCCAAAATCTTTCGGAAGCAACCCAATCACCAGAGGCACGACTTCCTCCGGATCAGCACGACTTTGACGCACATATCGGTCACTGGAGAAGCCTG
TGAAGCGCTTGGACAGCTCATAATCACGGGAGGAAGCCTCAACATCAGTACAAGACAAAGCAGATAGCGCCACTGCCAGTGAGAGCAGCCAAGCGCCTAT
CATGTCGCCACCGCTGCCTCGATCGGATGCTGTAAGTGTGCGATGTGACGTACTGGACTCATGATCGGTAGAGAGCTCGTGATTCTATTCGTCAAAATTC
ATTTTAACGAATCATATCACTTGATCCATCTGATTCTAATTCCCTTAGACAAATGTTGAATGTTATACTGATTTTCACTATACTTTGTCAACAGAAGACG
AATATGATGCTCAAGCCTGTGCCGTTCGTGCCGCCTGCATGGGCGTCGGCGCTGCGCCATCCTccgtccaagaagctccgCTTGGGCCACTTCCCCACTC
CGATATTGCCTTTCTCCCCTCCTGGTCTTCCTGAAGGTGTGCGCATGTTCATTAAACGCGACGACTTCAGCGGCCTCGAGACTTCAGGCAACAAGATCCG
CAAACTCGAGTTTCTATTAGCAGATGCGCTGGAGCAGAAGGCTGATTGTATTGTCACGTGTGGAGGAGTCCAGAGTAACCACTGCCgagctacagctgca
gtCGCCAGAATGCTTGGCTTGGACTCGTATTTGTTGCTACGAACCAATAAGCCTGATGAAGACCCAGCACTTGTGGGGAATTTACTGTTTGACCGGTTCG
TTTTTATTTTGTGCTACAGAATTGGTTAAAATAGTCAAGCTGAAGTGCTAAATTGTGTATATTTGCTCGATGATATAGCATGCTGGATGCCAATATTATT
CAGATGTCCAGGCAAGAGTATGGCAAGTACGGCAGTGAAACTATGATCAAGGTAAACTATCCCATAGAATATATTATTGTTAGGTATTGTGATGACACAG
GAGTCTGATGGTTGAATTTGTATTTTTTGTAGCGTACTTGTGATCGACTACGGGAGGAAGGTCGTCGTCCGTATGCGATTCCAGTTGGAGGGAGCAATGG
ACTCGGCACATGGGGGTACATTGAAGCAATTGATGAGATCAACAACCAGTTGAAGGTTGGTCTAGACTTGAGTGAGTGCTGATTGGGAAGTGCTTGAATT
GATTGGGGGGGGTGATCTTTGTGGTGAACAGGAAAACGAGCTCAAGATCACGGACATAGCGTTCGCGTGTGGAAGCGgaggaactgcagctggTATCGGT
CTAGGGTCCTATCTATATGCCAAGGCTTACCCGGACGCGGCCCTGGACTTTGGAGCAAAAATTCCTAGTACGATACGTGCTAGTTTGAGCGTGTGCGGTA
AAATATAGTTACTGACTATGGTTTTGTGTATTTTGTTTGATACAGCGCACGCGTATATCGTGTGCGACAACGATGAATACTTTCACGGCCACATTGAAGG
CCAAATCATGCCTACTATGGGAGCACCGTCAAGCATCTCATCGCGGGAGTTTTTGCAGATCACCAATGCGCAGGGAACAGGTTATGCTCGTAGCACCAAA
AAGGAGTTGGAGTTCATCTACAGCGTGAGTCGCACGACGGGTGTCCTCATGGACCCTGTGTACTCGGGCAAGGCGCTCTTTCACCTCATTCGAGAGCTAA
ACGAGAAACCAGAGGTAAGAAAGAATCATGACGTAGTACGGGGTGCTGTGATCCCAGGGAAGTTGTGTTGCCTAATCGTCATTATTGTTTTTACAGAAAT
TCGTGGGGAAGTCTATTTTGTTTGTCCACACTGGTGGCCAATTCGGCATGTACGACAAGGTGAACGACCTTCAGGAGGTGATTCGTCAAGATCAAGTGAC
CCGTTTTGCGATGGAGTAAGCGTGCGTTTTTGCTTGGAATGATTCATGTATGCCCCATGATTCAGTCATGGTAATGGTAGCCGTAAAACCAATTTAATGA
TAACTATGGATATGATTCCTCGTACAATTATATGTTCCTCTATAATATATACTACTTGGATGGAGTTATGGTGTCGACGTCTTCGACTCGAACAAGCCTG
TCCGAAAACCTCAAATACTAAGTTGCTGTTATGCAGCTTCGTCCAAACGAAGCAGCCTGGGTACAGacgctctgctgctgccgcgcAATCTGCCGATCCG
GTTCATCTCGCCAGTTGGAGTTTGCTTCGACGTCCAATCGGTAGATTGGACGTTGTTTCAACAGTGTATACAGGGCGTAGACCGTTACGCCCGATTATCC
GGATGACGTATAGTGACGCGCCAAACGTCAACTTGGGAAGAGAACGGCTACTGTTTCTGTAGCCATGTTGCGCTCAGACTGGAATTCGAGGTGTCATGAC
CCAGGAACACCCGCATGTCACCGATGACACTTCATAGTTGAGTCAAGAGCTAAGCTAGCCAGTTCTGGTTGGTATCCGCGAAGCCTCTGTTGGTCTTCAC
AGACGCTCTCAATTCCTTGTTGAAGTGCCGACTTAACAGTTTCTTTTATGGCCAATTTCAATCCGGATAAAGCGAAACGTTGTATACACATGCCGggctc
catctccatctgtacgtgcttgctgttgcttggtAATACCTGGGCCGCCATGCTCATaacgaccagcagctcacttTTCAATCCACCTCGATGCTGACAA
CCAAGACGTGCGTTCCAGACTCCCAACTCTACTGTCAACTCGTCGCCCTGGCTGACTCTGCTGTACGTGTGTGCCAATGCTGTTGTGTAGACTCAAGACT
GCTGGACAAGTGCTGGGTCTCCCACGCACCTTCGGAAGCCGTGGCCTCCGCTTTGCAAGCACCACCTCGACCGACGACACACCATACTacgatgtggtgg
tggctggtGGAGGCGTCATGGGCTTCTCGACGGCCTaccacttggccagcacGTCCAACTTGAAGATCGCCGTTGTGGAGAAGGACCCTTGCGTACGTCC
TCGATAGAGGAAATGTTGCTCTCTTGTACTGTAAATACGACGCTGACTGTGTGCTTactgttttgttttttacTGTTATTGCAGTACAAATATGCGTCTG
CAATTCTCTCGGCCGGTGGGATCCGCCACCAGTTCTCCGAGAGAGAGAACATTGAGATGAGTCTGTACGGTACAGAGTTCCTCAATAATATGGGCACGAA
CCTCAAAGTGGACGGCCATGATGCCCCTGATGTGCAGTTCGTGGAGGGGGGCTACATGTTCTTAGCCGACGAGAGCGGGCTGGACACTCTCCACAGGAAC
TACGCCGTGCAAAAAGAGACGGGTGCAGacgtgcagttgctggacgctgctgcactcaAGAAGCGCTTCCCGTGGATCAACACGGACGGTGTCGCTCAAG
GTGTACTGGGGATGAAGAACCAGGGATGGTTCGACCCGTGGGCGTTCTTGAATGCCATGAAGCGCAAGAGTATGGACCTGGGTGTGGACGTACTGGAAGG
CGAAGTCAAGCACTTTGACCTTGGCGGCCAAAACCAGATCGAAAAGGTCCACATtgagatgaagaactcgcCAGAGTGCGAAGATCTGCGTTATAATTCG
GTTCGAGCTGGTTCCGTCGTGAACGCTGCAGGATGCTGGTCGGCCAAGCTTCTGGAGGCTTGCGGTAGCTTTGATTATCCGGTGAAGCCCCGCAAGCGGT
CAATGTTTGCTTTCCATTGCCCCGTTGATGAGATTTGGAAGGGCCCGGCTGCTACGCCGCTCGTGATAGACCCGAACGGAGTTTACTTCCGACGTGAAGG
CTCCGGTGGACGGTTTGTATGCGGTTGGTCACCTGAAGCCGAGAATGACTACGATGGACAGACAGTTGAAGAGCTAGATAACCCCGATCACGATCACTTT
GACGAGCAGATCTGGCCCACCATTGCGCACCGAGTCAAGGACTTCGAGGCCCTAAAGGTGTTGAGCGCGTGGGCTGGATACTACGACTACAACACACTCG
ACCAGAATGCTATCATCGGATTGCATCCAGATGTGCCCAATATGTACCTTGTCAACGGCTTTAGTGGCCACGGGCTACAGCAATCACCCGCCGCGGGCCG
TGCTATCTCCGAGCTTATCCTTCATGGAGAATTCAAGACAATTGACGTCTCGCGTTTCAGCTTTGACCGCGTCCGTGCTAACGATCTGTTCGTAGAGCAG
GGGATTGTGTAAGTGATCAAACCCGAAGCTTAAGGAAGCTTCCATTTGAAACATGTGCCGTCTTCCATTAAACGCAATAAAAGTCTAACGTTAGGATGAT
TTTTAATGGCGGTAGATGCACAAAGACGTCTTTGAATTGCTAGCGTCCTGAGGCAGTGACCACGCATTGTTTTGTGTGGCTTCACTGAGCTCTTGCACTT
CTGTGAGCCGTGCATTCACTGTATAAATTACTTGCTTGTATCCAGAGATCTCTTCTCGTCGTAGTCGTGCGAGCTCCTCGGCGCAACGTTTTCCATCACG
CAGTTTCTGCGTGCGCAAAATAAGCTGCGCCTCGCGTTCACGTGCAtcttgcttgtgctgctctATCAGCAACTCGTGTTTGTCAAGCAAATCTGCAAAT
TCAGTCTTGAGAGCCATCAACTCCTCTGTCCGCTCATCCAACGCATCCTGGGCTCTTTGAGCCGTCGACACTGCCGCCTCCCGCTCTttagctgcagctt
cttcacgttgTGTTAGCAATTTGCACTCACTCTTcgcctccttcagctccaacACTACACGATGTTGCTCGTCCCCCCAgctcttctccttcagcctATT
TCGCTCGTTCTGCTCCAGCGACTGCGACCTCTCACTCGAAGTAgttgcaagctgcagctgcaacgcagccttctcctctctGGTCGTCTGCAACGTCACT
TCCAACCTCTCGATCTTCTTTACGTACTCTGTAACAGCTCCATCAACATCTGAAGACATCTGCCTGGCATTCAGCAACTCCTGCTTGAGCGCTTCCACCT
TCACTTGATGCTCCCTTGCAATCTGCTGCCAGAGCTCTCTTACacgcttggcatcgctcTCCGTCCTCTGTACCAGCTGGTCTCTATTAACTTTAAGAGC
CCTTGCCTCCTCTGCTGCCAACTCAGCTTCCGTCACCGCCAactctttcttctccacctccttcttccacttggtctccatcgccttgaGTTCCGCTGCC
AGCGCTGTATTCTTCTGTGTAGCAGCGTTCCTGCCCAGCACCGCCATCTTGTGCattgcagcttcatcctccagctccttctccactgtCGAGAGCTTAT
CTCGAGCCTGTTGAGTCGCCTGGGagctgcgctgctgcacatGACGCAGCTCCAATTCCCGCAGCTGCGCCTCATTCTCCAGCGTCGCCCGTGCTGCTTT
TTCCTGAGCCAACCGACGCGtcagctcttccacttcaagtcTCAATGCATCACGTTCGTCCTCCAGTCGTCGTGTGAGCTCTGGGAGGCTCTTGGACGGA
GCAGGAGAATCATCCTCCATGGTTGCGATCCCCACGCGCCAAAATTTGAATTTCACGATAAAATTAAACAAACAAATTTGAATTTGACGGCAGAATAGTT
CCTCAATATTTATAAAAGTACTTCCAATTTAATTAAATTATTATTAGTTAAGTACGAATTGATGAGATGGCTACACAACAGCGGTAACGGCTAACGTTGC
ACCGGAGTCACCCCATCTGAACTTTGCTGAACGCCAATGGCTCAACATCGTGTGACCCCGCCGAATGCAGCTGATTATACTGTAGTTGGCGATCCACGAA
TAAATGCAAGGCCTTTTTGTGGAGTGCAAGGCTGGATCTGCGGTCTCAGCGCACTGTCAGGCTTCCTCTTTGGTTATGACCTGTGCGtcatggtggtggc
gctACCACTTATTGAGCAGGTGACGGACATATTGCGCAGACATCTCGAAACAACTTACGTTTTTGTGTGCTGATGGGTGGCGATATTTTACTATGATATG
GTAGGACTTTGAGCTGTCGACGTCTTCGGCTGAGAGTGTTGTGAGCACACTCATGCTTGGCGCAGTGATCGGGTCGCTGGTTGGTGGGTTCGTTTCGGAT
TGGTACGAGCTTCTGTTAAAAAATGCTGGTTAGAAACTCAAGAACTGATGGTATTTTGCGGCGTTGTCTCGGTAGGATTGGTCGTAAGCCTGCCAACTTG
ATCACTGCCGCGCTCTTCCTGGGTGGATCGTTGTTGATGACATTTGCAGGGTCGTTGCGCACAATGCTAGTCGGGCGCTTTATTGCTGGTCTGGCAGTTG
GTAGCAGTGGGCCGTGTGTATCGACATATGTGGCTGAAATTGCCCCGCCAAAGACTCGCGGAGCACTTGTAACGATCAATGAGGTGCGTGCAGTTTCACC
GTGCATTAATGACGTCGAATGGATTATAGACAAACAAAATCACGGTCTGATTTGACAAACTCAGGTCATGGTGTGCTTTGGCTGCCTCTTATCGGTTGTC
GTGAGTGCTGGGCTACAAGATAGTGCGGTGGGGATGACATACCACATGCCTGCTTACCCTCTACGTTCAATCTGACTTGAAGTGCAACTCGTGTTTGGGA
TTGTGATTTCTGCTTGATAGAACGGTTGGCGAAAGATGCTCGGCATGACGCTATTTCCTCCGATTGTCCAATTGGTGCTGAATCGTTGTTCATTTACAAG
TAGCACAGGCATTTTGTTCGATACCTAATTTGGCTTGGCTTGGTTTTGTTTGAAATTCTCTGCAGGTTGGAATGCCATTCCTACCTGAATCGCCTCGTTG
GCTGATATCGGTGAGATTTAGTTGTCAAACCACTTCGAATTTCAAAAACGCACCTGTATTAACATGTAAATCCACGATTTTTATTGTAGAAGTATCGGAC
GAAGGAAGCAAGTGCCGTACTAAAGCGGTTGCTTTACACTGAAGATGCATCGCAAAAAATCATCCAGTCACACCTTGATACGGGGGTACGCTTGGTTGTG
CAGTTTTGGATTATACTTTGCTAGATCCCTGGCTAACTGTGCTCTGCCTTACAGAGATTTCATAATGGCTTTTTCCACGCATTGAGTGAGCTGGTGACAG
ACGAAGTGACTCGAAAGTGCGTGACCTCAGTATTTGCAGCGGGCACCATTATGCTGTATTAATTGTTGGACCTTGATCATTTAGGCGCGTCGTGTTTTGT
GTAGCTATCGCGTTTTGCCACATCTTGACGGGGGCAAATGCAATGCTGTACTACTCAAGCTACATTCTGCGCAAGTTGCACAATGGAGACCACTTGCTAG
TCTCTCACCTCAGCAAAGAAGTATGGGTGGGCGTCGCTAAACTTGCTGGTGTATGTTTGGCCGTCGTGATCGTGGATCGTGTTGGCCGTCGCCCACTACT
GCTCATCGGTACCAGTCTGATGCTGAGCTGCCACTTCATTTTCGCGCTTTGCTTTTGGACCCTCAATATGACGCACTCTGAGACCGTGCAG